DNA Sequencing and Microarrays

1. DNA Sequencing and Microarrays Janelle Dy, Cameron Kneib, Bailey Robinson

2. History of Sequencing • 1973- Walter Gilbert and Allan Maxam sequence 24 bp • 1975- Frederic Sanger develops chain-termination method • 1987- Applied Biosystems sells first sequencing machine- ABI 370 http://en.wikipedia.org/wiki/Frederick_Sanger

3. Sanger Sequencing and Other Sequencing Methods • Chain Termination Sequencing- uses radioactive markers on primer • Dye Termination Sequencing- uses florescent ddNTP markers • SMRT Polymerase Sequencing 5`>>>>CTAATTACCATGACAAGAACATTGTATTACTTAAAAACAAGGCAGTGCTAATGCCTAATGGTGCTACAGTTTCTGCCTCTTCCGTGGAACACACACATGGTGAACTCCTGGAAAAAACACTGTCTCAATATTATCCAGATTGTGTTTCCATTGCGGTGCAGAAAACCACATCTCACATAAATGCCATTAACAGTCAGGCTACTAATGAGTTGTCCTGTGAGATCACTCACCCATCGCATACCTCAGGGCAGATCAATTCCGCACAGACCTCTAACTCTGAGCTGCCTCCAAAGCCAGCTGCAGTGGTGAGTGAGGCCTGTGATGCTGATGATGCTGATAATGCCAGTAAACTAGC>>>>3`

4. Reagents • Primer • dNTPs • deoxynucleotide • ddNTPs • Dideoxynucleotide • Taq Polymerase • DMSO • DNA (PCR product) http://askabiologist.asu.edu/expstuff/mamajis/sequencing/sequencing.html

6. Chain Termination

7. Sequence determined by Electrophoresis • Read from bottom to top • Band indicates a terminated sequence • However it is often hard to read http://www.ocf.berkeley.edu/~edy/genome/sanger.jpg http://www.campus.skelleftea.se/biomine/molecular/images/pic026.gif

8. Dye Termination Sequencing • Can be done in a single tube. • Accurate • Fast (high speed capillary electrophoresis) • Readable http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_041894.pdf

9. Florescent attached to each ddNTP nucleotide • Single lane electrophoresis • Sequence is read by an argon laser that excites each florescent bp as it passes by. • Can only sequence 650~800bp per reaction http://www.bio.davidson.edu/Courses/Molbio/MolStudents/spring2003/Obenrader/sanger_method_page.htm http://en.wikipedia.org/wiki/File:CE_Basic.jpg

10. Sequencing Steps 3. Run sequencing reaction 1 .Run PCR reaction 2. Run a gel to qualify PCR product https://products.appliedbiosystems.com/ab/en/US/htdocs/productMgr/images/Product-shots-003_thumb.jpg http://www.mckinneychicago.com/extranet/abiinnovations/02/images/thermalcycler.jpg http://www.mun.ca/biology/scarr/377_gel_files_narrow.jpg https://sites.google.com/a/luther.edu/genetics/a_/rsrc/1235684393551/students/eve-doyle/electrophoresis/Electrophoresis.jpg

11. Ethidium bromide Gels Good Gel Bad Gel Can be sequenced

12. Background Noise

13. Uses • Human Genome Project • Forensics • Paternity Testing • Identifying diseases and disorders • Finding similarities between species • Identifying unknown species in the environment • Mutations

14. What is DNA Microarray Technology? • Nearly all cells in an organism contain the same genes, however each cell “expresses” different genes distinguishing different cell types from one another and making them unique. DNA Microarrays allows us to look at many genes at once and determine which are expressed in different cell types. • A microarray is a tool for analyzing gene expression that consists of a small membrane or glass slide containing samples of many genes arranged in a regular pattern https://www.broadinstitute.org/files/news/stories/full/OneChip.jpg

15. How does it work? • Sample Cells are collected • RNA is extracted from samples • A solvent is used to dissolve sample separating DNA, Proteins, RNA, other cell parts. • Spin samples in vortex mixer to help dissolve sample • Place samples in centrifuge to separate the mRNA from other cell parts. RNA will be floating. • Remove the floating layer of RNA • Separate mRNA from by running sample through a column that sorts out mRNA. • mRNA attaches to Poly-T beads. Detach using a buffer that prevents hybridization

16. Make cDNA copy of mRNA and attach fluorescent label to cDNA • A solution that contains the enzyme reverse transcriptase, poly-T primers, labeled nucleotides that have fluorescent molecule attached, is used to copy mRNA into DNA. • A micro array is a slide covered with spots of single stranded DNA. Each spot represents a certain gene.

17. Place cDNA sample onto the microarray . Hybridization will occur where complementary DNA from different sources pair together to reform a double stranded DNA molecule. • DNA that does not pair with DNA is washed off by submerging in a washing solution • A Microarray scanner is used to produce an image and see where cDNA bound to the microarray. • Results are shown in an image. The image will show information such as which genes are expressed in the cell type of original sample.

18. How are Microarrays used? • Microarray technology is used in cancer research to compare expressed genes in healthy cells and cancerous cells. • Helps determine which genes are used in certain cell types and infer possible gene function • To identify genes involved in the development of certain diseases http://gunston.doit.gmu.edu/liverdisease/LindaImages/microarray2.jpg

19. Pacific Biosciences • SMRT DNA Sequencing Technology • video • Long Reads, Short Run Time, and High Quality Data at Lower Cost

20. References • Campbell, Neil A., and Jane B. Reece. Biology . Ed. Lisa A. Urry, et al. 8th      Edition ed. San Francisco: Pearson Benjamin Cummings, 2008. • Hartwell, Leland H., et al. Genetics: From Genes to Genomes. 3rd Edition ed. New York : McGraw-Hill, 2008. N. pag. Print. • Canfield, Elizabeth. "Sanger Method for DNA sequencing ." Bio 111. Davidson University , 2001. Web. 30 Sept. 2009. <http://www.bio.davidson.edu/Courses/Bio111/seq.html>. • "Technology Demo." Pacific Biosciences Inc. . Pacific Biosciences, 2009. Web. 30 Sept. 2009. <http://www.pacificbiosciences.com/>.