1 / 8

Vicki & Joe

Vicki & Joe. Bioinformatics DNA -> RNA-> Protein Codons 64 Different Codons Replication -> Transcription -> Translation Sequence Alignment. DNA: AGTCTCGTTACTTCTTCAAAT RNA: AGUCUCGUUACUUCUUCAAAU Codons: AGU CUC GUU ACU UCU UCA AAU Protein: SLVTFLN AGU - serine - S- ser

sarah
Download Presentation

Vicki & Joe

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Vicki & Joe

  2. Bioinformatics • DNA -> RNA-> Protein • Codons • 64 Different Codons • Replication -> Transcription -> Translation • Sequence Alignment

  3. DNA: AGTCTCGTTACTTCTTCAAAT • RNA: AGUCUCGUUACUUCUUCAAAU • Codons: AGU CUC GUU ACU UCU UCA AAU • Protein: SLVTFLN AGU - serine - S- ser CUG - leucine - L - leu GUU - valine - V - val ACU - threonine - T - thr UCU - phenylalanine - F - phe UCA - leucine - L - leu AAU - asparagine - N - asn

  4. Simple comparison between sequences • Matches • Mutations • Different Letters In Both Rows • Insertion • Space In Top Row • Deletion • Space In Bottom Row

  5. Input: DNA Sequence • “1921 attttataga aaaatctctt” • Cleans The String • attttatagaaaaatctctt • Searches: • TTA, CTA, or TCA (Start Codons)‏ • CAT (End Codon)‏ • Checks Size (Pseudogene, Potential Gene)‏ • Output: • Potenial Gene String

  6. DNA-RNA-Protein • Nobelprize.org • Genetic Home Reference • ghr.nlm.nih.gov • A Science Primer • ncbi.nlm.nih.gov • Computer science and bioinformatics • Communications of the ACM • Volume 48 ,  Issue 3  (March 2005)‏

  7. Quiz 1. How many chemical bases are in a codon? 2. What is one starting codon and the end codon? 3. How Many Different Codons are there? 4. How many amino acids are there?

More Related