'New training set' presentation slideshows

Gene Prediction and Annotation techniques Basics

Gene Prediction and Annotation techniques Basics. Chuong Huynh NIH/NLM/NCBI Sept 30, 2004 huynh@ncbi.nlm.nih.gov. Acknowledgement: Daniel Lawson, Neil Hall. GATCGGTCGAGCGTAAGCTAGCTAG ATCGATGATCGATCGGCCATATATC ACTAGAGCTAGAATCGATAATCGAT CGATATAGCTATAGCTATAGCCTAT. What is gene prediction?.

1.13k views • 49 slides

Learning Models for Object Recognition from Natural Language Descriptions

265 views • 14 slides