1 / 32

What Is Microarray

What Is Microarray. A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale. Microarray. Replication. Transcription. Translation. DNA. RNA. Protein. Reverse transcription. DNA. ATATCGGCATCAGTCGATCGATCATCGATCGAT. mRNA.

shad-hansen
Download Presentation

What Is Microarray

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. What Is Microarray • A new powerful technology for biological exploration • Parallel • High-throughput • Large-scale • Genomic scale

  2. Microarray

  3. Replication Transcription Translation DNA RNA Protein Reverse transcription DNA ATATCGGCATCAGTCGATCGATCATCGATCGAT mRNA UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA cDNA ATATCGGCATCAGTCGATCGATCATCGATCGAT

  4. What Is Microarray • Different Approaches

  5. Affymetrix • Probe Array (Photolithography) • Synthesis of probe • Hybridization

  6. Stanford Approach • Use robot to spot glass slides • Able to measure qualitatively relative expression levels of genes • Differential expression by use of simultaneous, two-color fluorescence hybridisation • Cheaper with DIY ($60,000) • Also called home-made system

  7. Life Cycle(cont.) Cy3 (green) Cy5 (red)

  8. Arrayer Hardware Scanner Software Procedures • Preparation • Target DNA (reference and test samples) • Slides • Reaction(Droplet or Pin Spotting) • Hybridization • Scanning • Analysis • Image processing • Data mining • Modeling

  9. Instruments • Arrayer • Scanner • Laser Confocal Microscope

  10. Arrayer

  11. Scanner • GenPix 4000

  12. Problems – by direct view Anti-probe Locally high background Spot overlap Precipitate Locally low signal Comet-tails (donut hole)

  13. Problems –related wit IP • Local problems • Spot position variation • Spot shape and size irregularity • Spot Overlapping • Global problems • High background • Low signal • White-noise/Speckle effect (Contamination)

  14. Array Alignment Good Alignment Bad Alignment

  15. Spot Finding • Grid System Determination • Manual • Semiautomatic • Automatic • Spot Segmentation • Space-based • Intensity-based • Frequency-based • Hybrid approach

  16. Grid System Determination

  17. Spot Segmentation

  18. Spot Segmentation(cont.)

  19. Applications • Gene expression studies • Gene function for cell state change in various conditions • Disease Diagnosis • Pathogen Analysis

  20. Applications(Cont.) • Drug Discovery • identify appropriate molecular targets for therapeutic intervention • monitor changes in gene expression in response to drug treatments • Trageted Drug Treatment

  21. Example Images – E. Coli

  22. Example Images – C. Elegan

  23. ….. Gene index 1.75 Log(R/G) …..

  24. Log(R/G) Log(R/G) Log(R/G) ….. ….. ….. ….. ….. ….. …

  25. M experiments N gene …..

More Related