1 / 30

Protein Synthesis

Protein Synthesis. AP Biology Ch. 17. “One Gene-One Polypeptide” Theory. George Beadle and Edward Tatum (late 40’s to early 50’s) used X-rays to induce mutations in Neurospora crassa (bread mold)

shauna
Download Presentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein Synthesis AP Biology Ch. 17

  2. “One Gene-One Polypeptide” Theory • George Beadle and Edward Tatum (late 40’s to early 50’s) • used X-rays to induce mutations in Neurospora crassa (bread mold) • Auxotrophs—nutritional mutants unable to synthesize certain amino acid and vitamins. They traced the defect to the enzymes involved in their synthesis. • Conclusion: One gene encodes one enzyme. • Gene products encode both protein and RNA

  3. RNA Proteins Central Dogma of Molecular Biology • In eukaryotic cells, a message (mRNA) carries the genetic information (DNA) from the nucleus to the cytoplasm  Transcription • An adapter (tRNA) translates the nucleic acid (mRNA) into amino acid (protein)  Translation • Information flow is unidirectional GCTGCTAACGTCAGCTAGCTCGTAGCGCTAGCGCTTGCGTAGCTAAAGTCGAGCTCGCTTGCGTAGCTAAAGTCGAGCTGCTGCTAACGTCAGCTAGCTCGTAG

  4. Structure of RNA • Single strand of nucleotides [instead of 2 strands in DNA] • Nucleotides contain 5-carbon sugar ribose [instead of deoxyribose in DNA] • 4 different nitrogenous bases • Adenine (A) • Uracil (U) [instead of thymine in DNA] • Cytosine (C) • Guanine (G)

  5. Forms of RNA • 3 Main Types of RNA • mRNA (messenger RNA) brings DNA message out of nucleus to the cytoplasm • Each 3 bases on mRNA is a “codon” • tRNA (transfer RNA) –The anticodon that matches with the codon from mRNA to determine which amino acid joins the protein chain • rRNA (ribosomal RNA) – make up the ribosomes—RNA that lines up tRNA molecules with mRNA molecules

  6. Transcription: Synthesis and Processing of RNA • RNA Polymerase is an enzyme that synthesizes RNA using one strand of the DNA as a template • Separates 2 strands of DNA and links RNA nucleotides as they base-pair along the DNA template in an overall is 5’ to 3’ direction

  7. Transcription: Initiation • RNA polymerase attaches to promotor sequence (TATA box) of DNA sequence • Prokaryotes—enzyme binds directly to sequence • Eukaryotes—enzyme binds after transcription factors bind to the site

  8. Transcription: Elongation • RNA polymerase • Synthesizes in 5’ 3’ direction, anti-parallel to DNA template • Unwinds about 20 base pairs as it reads and synthesizes complementary RNA

  9. Transcription: Termination • RNA polymerase terminates transcription at special DNA sequences, terminator • Prokaryote—stops right at the end of termination signal • Eukaryote—continues past termination signal, to a poly(A) tail (AAUAAA) in the pre-mRNA

  10. Transcription • The code on DNA tells how mRNA is put together. • Example: DNAACCGTAACG • mRNAUGGCAUUGC Each set of 3 bases is called a triplet or codon (in mRNA) UGG CAU UGC

  11. RNA Splicing • Pre-mRNA never leaves the nucleus • Introns—non-coding regions • Exons—coding regions • snRNPs join with other proteins to form spliceosome, which releases introns

  12. Translation • Genetic information in mRNA is read by codons • 64 different codons • Genetic code is redundant—more than one codon codes for many of the 20 amino acids • AUG—universal start codon • UAA, UAG, UGA—stop codons

  13. Structure of tRNA

  14. Aminoacyl-tRNA Formation

  15. Structure of a Ribosome

  16. Translation: Initiation • Small ribosomal subunit binds to start codon (AUG) on mRNA • Initiator tRNA (UAC) base-pairs with mRNA • Large ribosomal unit binds so initiator tRNA is in the P site • GTP provides energy for intiation process

  17. Translation: Elongation

  18. Translation: Termination Review entire process

  19. Coupled Transcription and Translation in Bacteria

  20. Point Mutations

  21. Substitution Mutations • Missense mutation: altered codon still codes for an amino acid, although maybe not the right one • Nonsense mutation: altered codon is a stop codon and translation is terminated prematurely • Leads to nonfunctional proteins

  22. Insertions and Deletions • Frameshift mutation: addition or loss of one or more nucleotide pairs in a gene shifts the reading frame for translation and incorrect protein is made

  23. The end

  24. Ribosome Reading direction 5’ 3’ U U C U G G A U G U G G U U C U G G mRNA A C C C U A U A C Incoming tRNA charged with amino acid Met Met Trp

  25. Ribosome Reading direction 5’ 3’ U U C U G G A U G U G G U U C U G G mRNA C C A G A A C A U Outgoing “empty” tRNA Trp Met Phe

  26. Ribosome Reading direction 5’ 3’ U U C U G G A U G U G G U U C U G G mRNA A C G C A A C C A C A U Met Phe Trp Trp

  27. Ribosome Reading direction 5’ 3’ U U C U G G A U G U G G U U C U G G mRNA C C A A C C C A A A G U Phe Met Trp Trp

  28. Ribosome Reading direction 5’ 3’ U U C U G G A U G U G G U U C U G G mRNA C C C A A U A A G C A U Outgoing “empty” tRNA Incoming tRNA charged with amino acid Trp Met Phe Anticodon C A C G A A Trp Phe Amino acid

More Related