1 / 4

tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg

A. Germline CCDC6. 1,021-nucleotide deletion. atgcatagtcacctttttga ▲ gtagcttttgtatgttaggc. tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg. …981Ns…. Germline RET. 52-nucleotide deletion. RET-030.

solana
Download Presentation

tcacctcctgtagggcatct ▽ tggttgtttccaccttttgg

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A GermlineCCDC6 1,021-nucleotide deletion atgcatagtcacctttttga▲gtagcttttgtatgttaggc tcacctcctgtagggcatct▽tggttgtttccaccttttgg …981Ns… GermlineRET 52-nucleotide deletion RET-030 gaggagcagtgcttccacac▲tctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagaga▽agttgtcctggacacttcca CCDC6-RET NHEJ RET-CCDC6 B atgtatcataatttatctcttcacctcctgtagggcatct▽agttgtcctggacacttccactgtagtcagaggtcctggg GermlineKIF5B 19-nucleotide deletion GermlineRET 14-nucleotide deletion gagggccagtggcagcccttgaggagcagtgcttccacac▲gtagcttttgtatgttaggccagatctgttggtttgtcct L07K201T NHEJ aggaactcccaaatggtctt▽c▽caaagtggtggaaacattt▲tgcattcctatcagccatga KIF5B-RET actatgttagctttgtaaggaactcccaaatggtctt▽c▽atagGAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTT “c” nucleotide overlap RET-KIF5B tttcccccctcttctccccc▲ttccctcatttccaa▽c▽atagGAGGATCCAAAGTGGG cttcctcccctgtcatcctcacacttttcccccctcttctccccc▲ATA▲tgcattcctatcagccatgaatgagagtctgctgttccacatc “ATA” nucleotide insertion • SUPPLEMENTARY FIGURE1. Breakpoint and junction sequences of two representative cases with reciprocal inversions deduced to have been mediated by NHEJ. The structures of the two resultant fusion DNAs enabled us to deduce the nucleotide deletions in the RET, CCDC6, and KIF5B loci. Nucleotide insertion at the breakpoint junction, a feature of NHEJ, was observed in L07K201T. ▽, breakpoints for partner-RET fusion; ▲, breakpoints for RET-partner fusion.

  2. A BR0030 KIF5B-derived segment of 211-bp duplicated after gene fusion GermlineKIF5B ttttcctagt▲ ctagctgcag …33Ns… ctaacataaatatgggttatgtatagaaatttaccagaatgatgtgactggtggtaacttgttaa agacttcagaattccagggtgggcaaaactgcagggaaccagtttcctggcttggcaactgaatgaa …26Ns… tcacaaggag▽ggaagatggtaa GermlineRET catggcaggctttggcctccctggtcagagttcaagtactgggggccagggtgggggtctgggaaggcatccggagcagtcccaagtgggcccaatgtgtggatagaactttggtgggagggcagggtggtagtgccagcaggcagggtgagc ▲▽gggtgcgtgagggccagtggcagcccttgaggagcagtgcttccacactctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagagaagttgtcctggacacttccactgtagtcagaggtcctgggctgggcctggtg Nucleotide sequence homology RET caggctttggcctccctggtcagagttcaagtactgggggccagggtgggggtctgggaaggcatccggagcagtcccaagtgggcccaatgtgtggatagaactttggtgggagggca gggtg | ||| | | | | || | || | ||||| || || | | | || | ||| |||||| || || | | ||| ||| |||| KIF5B ataaatatgggttatgtatagaaatttaccagaatgatgtgactggtggtaacttgttaaagacttc--agaattccagggtgggcaaaactgcagggaaccagtttcctggcttggcaactga RET agggtggctatgtagagaagttgtcctggacacttccactg-tagtcagaggtcctgggctgggcc || ||||| |||| || || | | | |||| | || | || | || atatgggttatgtatagaaatttaccagaatgatgtgactggtggtaacttgttaaagacttcaga KIF5B BIR KIF5B-RET Gttgtttttttcctagtctagctgcagtaaatttgaatgatttaactgag……150bp……ttcaccactatcagaatttcacaaggag▽gggtgcgtgagggccagtggcagcccttgaggagcagtgcttccacactctg Duplication of a KIF5B-derived segment of 211-bp RET-KIF5B cccaatgtgtggatagaactttggtgggagggcagggtggtagtgccagcaggcagggtgagc▲ ctagctgcagtaaatttgaatgatttaactgag……150bp……ttcaccactatcagaatttcacaaggagggaagatggtaacgttagatgg • SUPPLEMENTARY FIGURE2. Breakpoint and junction sequences of two representative cases with reciprocal inversions resulting in segment duplication. (A) A KIF5B segment between two breakpoints (▽, KIF5B-RET fusion; ▲, RET-KIF5B fusion) has sequence homology with two regions encompassing breakpoints in the RET locus. The regions exhibiting homology are underlined in red and blue. The resultant fusion DNAs contain duplications of the KIF5B segment.

  3. B AD12-106T GermlineKIF5B agttaaaaagtgtaaagagagagtggaaatggtttatgtttagtggcagagggatgaaatccaggttccatgactactagatttttttttccactataccatagcagtttgaaaataagtcgtctttgcaaa tagttattctaattaaaaaaaaaaaaggat …51Ns… agctctgttagag▽cgttactttt …553Ns… tagttggaat▲catacagtatgtatatgtagccctttcagctagtttctttcactt accagtatgcatttaagattcttccatggcttttcatggcttgatcattttttta 573-bp deletion GermlineRET RET-derived segment of 490-bp duplicated after gene fusion ctcagtatttgag▽ aggatcaggttgatgtcgccctcatgtgcttattgcagtctctagagtgtggtaaacaggtttccagtgcca……270bp……tggtgggagggcagggtggtagtgccagcaggcagggtga gcgggtgcgtgagggccagtggcagcccttgaggagcagtgcttccacactctgaggcggaacatggtggcgcctttctttgcaggggtggctatgtagagaagttgt ▲cctggacactt Nucleotide sequence homology RET ttggtgggagggcagggtggtagtgccagcaggcagggtgagcgggtgcgtgagggccag-tggcagcccttgaggagcagtgcttccac---actct-g-aggcggaacatggtggcgcctttctttgcaggggtggctatgtagagaagtt ||| | | || |||| | || | | ||| || | | ||| |||| | || || || | |||||| || | | || ||| || | || |||| || | ||| || | || KIF5B aaagtgtaaagagagagtggaaatggttt-atgtttagtg-gcagagggatgaaatccaggttccatgactactagatttttttttccactataccatagcagtttgaaaataa-gtcgtctttgcaaatagttat-tctaattaaaaaaaaa RET KIF5B BIR KIF5B-RET ttcttttcctctcatcatatataagctctgttagag▽ aggatcaggttgatgtcgccctcatgtgctt……430bp……ttgcaggggtggctatgtagagaagttgtcctggacacttccactgtagtcagaggtcct Duplication of RET-derived segment of 490-bp RET-KIF5B ggatcaggttgatgtcgccc--tcatgt-gcttattgcagtctctagagtgtggtaaacaggtttccagtgccagct Ccaggtcttggacccatgactcaacctcagtatttgagaggatcaggttgatgtcgccctcatgtgctt……430bp……ttgcaggggtggctatgtagagaagttgt▲catacagtatgtatatgtagccctttcagct | || |||| |||| ||| | | || || || | | || || | || | ||||| || acagtatgtatatgtagccctttcagctagtttctttcacttaccagtatgcatttaagattcttccatggcttttc • SUPPLEMENTARY FIGURE2. Breakpoint and junction sequences of two representative cases with reciprocal inversions resulting in segment duplication. (B) A RET segment between two breakpoints (▽, KIF5B-RET fusion; ▲, RET-KIF5B fusion) has sequence homology with two regions encompassing breakpoints in the KIF5B locus. The regions exhibiting homology are underlined in red and blue. The resultant fusion DNAs contain duplications of the RET segment.

  4. RET stop ATG 17 16 15 14 12 10 1 11 13 18 8 9 7 6 4 19 20 3 5 2 Repetitive sequence GC contents Conservation in mammalian DNase susceptibility Histone modification by Chip-seq from ENCODE/Stanford/Yale/USC/Harvard K562 H3K4me1 K562 H3K4me1 K562 H3K4me3 K562 H3K4me3 K562 H3K9ac K562 H3K9ac K562 H3K27me3 K562 H3K27me3 NT2-D1 H3K4me1 NT2-D1 H3K4me1 NT2-D1 H3K4me3 NT2-D1 H3K4me3 NT2-D1 H3K9ac NT2-D1 H3K9ac NT2-D1 H3K27me3 NT2-D1 H3K27me3 NT2-D1 H3K36me3 NT2-D1 H3K36me3 U20S H3K9me3 U20S H3K9me3 U20S H3K36me3 U20S H3K36me3 SUPPLEMENTARY FIGURE3. DNA and chromatin features of the RET locus. Locations of repetitive sequences are indicated in black. GC content, extent of conservation, DNase susceptibility (DNase I Hypersensitivity Clusters in 125 cell types from ENCODE), and histone modifications are shown by gray boxes, with darker gray indicating a greater extent or magnitude of each parameter. The data was obtained using the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway). The exon 11 to intron 11 region is indicated by a red box.

More Related