1 / 46

Everything you wanted to know about ENCODE

Everything you wanted to know about ENCODE . But were afraid to ask. Top 5 Reasons Biologists Go Into Bioinformatics. 5 - Microscopes and biochemistry are so 20th century. Top 5 Reasons Biologists Go Into Bioinformatics. 5 - Microscopes and biochemistry are so 20th century.

taite
Download Presentation

Everything you wanted to know about ENCODE

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Everything you wanted to know about ENCODE But were afraid to ask

  2. Top 5 Reasons Biologists Go Into Bioinformatics 5 - Microscopes and biochemistry are so 20th century.

  3. Top 5 Reasons Biologists Go Into Bioinformatics 5 - Microscopes and biochemistry are so 20th century. 4 - Got started purifying proteins, but it turns out the cold room is really COLD.

  4. Top 5 Reasons Biologists Go Into Bioinformatics 5 - Microscopes and biochemistry are so 20th century. 4 - Got started purifying proteins, but it turns out the cold room is really COLD. 3 - After 23 years of school wanted to make MORE than $23,000/year as a postdoc.

  5. Top 5 Reasons Biologists Go Into Bioinformatics 5 - Microscopes and biochemistry are so 20th century. 4 - Got started purifying proteins, but it turns out the cold room is really COLD. 3 - After 23 years of school wanted to make MORE than $23,000/year as a postdoc. 2 - Like to swear, @ttracted to $_ Perl #!!

  6. Top 5 Reasons Biologists Go Into Bioinformatics 5 - Microscopes and biochemistry are so 20th century. 4 - Got started purifying proteins, but it turns out the cold room is really COLD. 3 - After 23 years of school wanted to make MORE than $23,000/year as a postdoc. 2 - Like to swear, @ttracted to $_ Perl #!! 1 - Getting carpel tunnel from pipetting

  7. Top 5 Reasons Computer People go into Bioinformatics 5 - Bio courses actually have some females.

  8. Top 5 Reasons Computer People go into Bioinformatics 5 - Bio courses actually have some females. 4 - Human genome more stable than Windows XP

  9. Top 5 Reasons Computer People go into Bioinformatics 5 - Bio courses actually have some females. 4 - Human genome more stable than Windows XP 3 - Having mastered binary trees, quad trees, and parse trees ready for phylogenic trees.

  10. Top 5 Reasons Computer People go into Bioinformatics 5 - Bio courses actually have some females. 4 - Human genome more stable than Windows XP 3 - Having mastered binary trees, quad trees, and parse trees ready for phylogenic trees. 2 - Missing heady froth of the internet bubble.

  11. Top 5 Reasons Computer People go into Bioinformatics 5 - Bio courses actually have some females. 4 - Human genome more stable than Windows XP 3 - Having mastered binary trees, quad trees, and parse trees ready for phylogenic trees. 2 - Missing heady froth of the internet bubble. 1 - Must augment humanity to defeat evil artificial intelligent robots.

  12. The Paradox of Genomics How does a long, static, one dimensional string of DNA turn into the remarkably complex, dynamic, and three dimensional human body? GTTTGCCATCTTTTGCTGCTCTAGGGAATCCAGCAGCTGTCACCATGTAAACAAGCCCAGGCTAGACCAGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCATGAGT

  13. Looks like ‘code’ not enough, must study actual cells & DNA

  14. How DNA is Used by the Cell

  15. Promoter Tells Where to Begin Different promoters activate different genes in different parts of the body.

  16. A Computer in Soup Idealized promoter for a gene involved in making hair. Proteins that bind to specific DNA sequences in the promoter region together turn a gene on or off. These proteins are themselves regulated by their own promoters leading to a gene regulatory network with many of the same properties as a neural network.

  17. Regulation By Txn Factor Binding When I-KB is removed from by phosphorylation, NF-KB complex binds to dna. Note that you would need Both NF-KB p65 and NF-KB p50 Subunits to be expressed in same cell For this transcription activation Pathway to work. Selective, combinatorical expression of txn factors is very important In defining different types of cells.

  18. The Decisions of a Cell • When to reproduce? • When to migrate and where? • What to differentiate into? • When to secrete something? • When to make an electrical signal? The more rapid decisions usually are via the cell membrane and 2nd messengers. The longer acting decisions are usually made in the nucleus.

  19. Nucleus Used to Appear Simple • Cheek cells stained with basic dyes. Nuclei are readily visible.

  20. Mammalian Nuclei Stained in Various Ways Image from Tom Misteli lab

  21. Artist’s rendition of nucleus Image from nuclear protein database

  22. Chromatin

  23. Turning on a gene: • Getting DNA into the right compartment of the nucleus (may involve very diffuse signals in DNA over very long distances) • Loosening up chromatin structure (this involves enhancers and repressors which can act over relatively long distances) • Attracting RNA Polymerase II to the transcription start site (these involve relatively close factors both upstream and downstream of transcription start).

  24. HISTONE MODIFICATIONS 4 Modification Effect H3K4me3 H3K4me2 H3K4me1 H3acK9/14 H4acK5/8/12/16 Slide adapted from Christoph Kock, Sanger Institute

  25. Methods for Studying Transcription Traditional • Genetics in model organisms • Promoters/enhancers hooked to reporter genes • Gel shifts and DNAse footprinting. ENCODE/High Throughput • Phylogenic footprinting • Motif searches in clusters of coregulated genes. • Chromatin Immunoprecipitation & CHIP/CHIP • DNAse hypersensitivity

  26. Drosophila Genetics antennapediamutant normal

  27. Reporter Gene Constructs promoter to study easily seen gene Drosophila embryo transfected with ftz promoter hookedup to lacz reporter gene, creating stripes where ftz promoteris active.

  28. Biochemical Footprinting Assays Gel showing selective protection of DNA from nuclease digestion where transcription factor is bound. Txn factorfootprint

  29. Comparative Genomics Webb Miller

  30. Comparative Genomics at BMP10

  31. Conservation of Gene Features Conservation pattern across 3165 mappings of human RefSeq mRNAs to the genome. A program sampled 200 evenly spaced bases across 500 bases upstream of transcription, the 5’ UTR, the first coding exon, introns, middle coding exons, introns, the 3’ UTR and 500 bases after polyadenylatoin. There are peaks of conservation at the transition from one region to another.

  32. Normalized eScores

  33. Conservation Levels of Regulatory Regions in Human/Mouse Alignments

  34. Dnase I Hypersensitivity, CHIP/CHIP, transcription data on ENR333

  35. CHromatin ImmunoPrecipitation • Crosslink cells with formaldehyde. • Sonicate to shear DNA • Add antibody to a protein involved in transcription. • Precipitate antibody and and everything attached • Heat to release DNA. • Analyse DNA with PCR or microarrays • CHIP on microarray = CHIP/CHIP

  36. CHIP/CHIP in ENCODE • groups: Sanger, Yale, Affy, UCSD, Stanford, GIS (more?) • proteins: RNA Pol II, TAF1, histones in various states of acylation/methylation • cells: various cell lines treated various ways.

  37. CHIP/CHIP Groups • Sanger - sequencing center in UK that does a lot of annotation as well. • UCSD/Ludwig Institute - where Bing Ren, a pioneer of CHIP lives • GIS - Genome Institute Singapore - using “paired-end ditag” CHIP. • Stanford, YALE, Affy you all know.

  38. CHIP/CHIP Targets • RNA Polymerase II, converts DNA->RNA for protein coding genes. • Antibody targets form in initiation complex (start of gene) • TAF1 - A basal transcription factor. Involved in recruiting Pol II to initiation site • Histones 3&4 - the balls DNA winds around • Antibodies against various acylated and methylated forms, most of which are associated with chromatin opening

  39. Cell Types • HELA - cervical epithelial carcinoma • HCT116 - colon epithelial carcinoma • IMR90 - lung fibroblast • THP1 - blood monocyte leukemia • GMO6990 - lymphoblastoid • HL-60 - promyelocytic leukemia cell line • Many others in Stanford promoter track.

  40. DNAse hypersensitivity • Very old technique being adapted to high throughput. • DNA cutting enzymes can access open chromatin faster than closed chromatin • Other things may also influence how susceptible a particular piece of DNA is to DNAse cutting. • What is hypersensitive in a particular cell line is quite reproducible. • There are various techniques for seeing where cut is: sequencing cut ends, PCR around cut site, etc.

  41. Dnase I Hypersensitivity, CHIP/CHIP, transcription data on ENR333

  42. Dnase I Hypersensitivity, CHIP/CHIP, transcription data on ENR333

  43. Close up of same region

  44. The END

  45. How is a gene turned on? • “Pioneering” transcription factors bind to DNA and tag it for “chromatin opening” • Histones are acylated/methylated which opens chromatin. • More transcription factors bind newly exposed sites in DNA. • RNA Polymerase II attracted to txn factors • Yet more txn factors phosphorylate tail of Pol II, allowing it to start transcription.

More Related