Blood, Blood spatter and DNA Ch. 7 and 8

1. Blood, Blood spatter and DNACh. 7 and 8

2. Forensic blood video Blood spatter video Dexter-23456 * Science of Murder- blood *

3. Blood typing • If blood is found at the scene of a crime, it can be tested for blood type. This may narrow down suspects • – Cheaper, easier, and faster than DNA testing , which provides individual evidence

4. Blood spatter • A spatter pattern can give information about the truthfulness of an account by a witness or a suspect • It also can provide information about the origin of the blood, the angle and velocity of impact and type of weapon used

5. Composition of Blood • Whole blood has cells and plasma (fluid with hormones, clotting factors and nutrients) • Red blood cells carry oxygen to the body’s cells and CO2 away • White blood cells fight disease and foreign invaders • Platelets aid in blood clotting

6. What is blood typing? • Antibodies are proteins secreted by white blood cells that attach to antigens to destroy them (defense machanism) • Antigens are foreign molecules that react to antibodies • (causes agglutination or clumping) • In this case, antigens are carbohydrate tags on red blood cells that are read by your immune system • If your immune system recognizes them, everything is fine • If your immune system sees them as foreign, it attacks!

8. A person with type A blood has A antigens on the surface of their red blood cells. • A-type individuals do not make antibodies against A antigens. • A-type individuals make antibodies against B antigens

9. If a person with Type A blood receives a Type B transfusion, the anti-B antibodies will bind the B antigens • Donor cells are destroyed by complement-mediated lysis • Can lead to jaundice and kidney damage • Death • Therefore, they can only receive A or O blood

10. A person with type B blood has Bantigens on the surface of their red blood cells. • B-type individuals do not make antibodies against B antigens. • B-type individuals make antibodiesagainst A antigens • Can only receive B or O blood

11. A person with type AB blood has A and B antigens on the surface of their red blood cells. • AB-type individuals do not make antibodies against A or B antigens. • Can receive A, B, AB, or O blood • – Called the universal recipient

12. A person with type O blood has no antigens on the surface of their red blood cells. • O-type make antibodies against A and B antigens • Can only receive other O blood, but can donate to all other blood types • – Known as the universal donor

13. Type Percent • A 39 • B 12 • AB 4 • O 45

14. What is Rh factor? • Rh Factor is another antigen present on RBCs • – it’s where the +/- of your blood type comes from • – named after the Rhesus Monkey (where they were first discovered) • Can cause problems with transfusions • – Rh negative people can’t receive positive blood (get an antigenic reaction- destruction of cells) • Also get similar reaction when Rh-negative mother is carrying an Rh-positive fetus

15. If the sample clots, then the antibodies are binding, so the antigen must be present • – If Anti-A makes it clot, A is present –>A (AB) • – If Anti-B makes it clot, B is present –>B (AB) • – If both Anti-A and Anti-B samples clot, Both antigens are present –> AB • – If neither Anti-A or Anti-B makes it clot, neither antigen is present –> O • – If Anti-Rh makes it clot, Rh factor is present -> +

16. Human Blood Testing Blood Compatibility Is that Blood

17. Luminol Presumptive test • The first step in an investigation. • Seen on most CSI TV shows as the blue glowing light test. • Presumptive Test: Possibility that it is blood or it is not blood. • It uses luminol, a peroxide and a base.

18. Presumption Blood Testing(using the kastel-meyervideo) • Kastel-Meyer Blood Test • It will not prove that a sample is definitely blood, it simply supports the idea that the sample could be blood • Kastel-meyer is used because of ease of use, doesn’t destroy DNA and is very sensitive (can detect 1 drop in 10,000 drops), positive test results in easily seen color change due to presence of hemoglobin • Uses alcohol, phenophthalein (special prep- not the kind used in acid/base testing) hydrogen peroxide. • It undergoes a oxidation-reduction reaction • Look for no color change with the addition of alcohol and phenophtalein and blue color with hydrogen peroxide

19. Blood Spatter (dexter explain)(blood spatter interpretation)

20. Splatter is the sound a liquid makes when it comes in contact with an object • Spatter is the pattern blood makes on an object

21. Blood spatter • The pattern can help to reconstruct the events surrounding a shooting, stabbing or beating • Can determine: • Direction blood traveled • Angle of impact • Point of origin of the blood • Velocity of the blood • Manner of death

22. Common Bloodstain Patterns • Walking Drip Pattern • Wipes • Swipes • Transfer Stains • Arterial Spurts (vertical & horizontal) • Cast-off Spatter

23. When blood falls from a height or at a high velocity, it can overcome its natural cohesiveness and form satellite droplets • When it falls onto a less-than-smooth surface, it can form spiking patterns around the drops

24. Directionality • The shape of an individual drop of blood provides clues to the direction from where it originated

25. Shapes www.deviantcrimes.com/bloodspatter.htm Gun Hammer http://www.clt.uwa.edu.au/__data/page/112508/fsb05.pdf

26. Low Velocity - This type of spatter is usually caused by an impact to the blood source at a rate of 5 feet per second and is usually about 4 millimeters in diameter. • (victim walking) • Medium Velocity - This type of spatter is usually caused by an impact to the blood source at a rate of 5-100 feet per second.  Stains caused by this type of force are usually 1-3 millimeters in diameter, but may be larger or smaller. (bat-stab) •  High Velocity - This type of spatter is usually caused by an impact to the blood source in excess of 100 feet per second and is usually less than 1 millimeter in diameter, although it can be larger or smaller. • (gun)

27. Angle of Impact • http://www.bloodspatter.com/BPATutorial.htm

28. Creating Reference Bloodstain Patterns • http://bloody2.com/diameter.aspx

30. Blood spatter video Dexter-23456 Science of Murder- blood

31. DNAFingerprinting • A more modern and popular approach, • DNAfingerprintingcan be very conclusive • Alec Jefferys • DNA evidence

32. DNA can be isolated from many sources: Blood Semen Saliva Hair Skin cells Bone Teeth Tissue Urine Feces Vomit Condoms Hat bands Bras Cigarette Butts Chewing gum Envelopes Drinking Cups Under victim’sfingernails

33. Running DNA Video • Death, drugs, driving and DNA: Forensic Potpourri (you tube or Research Channel)

34. PCR (Polymerase Chain Reaction) is used to make a small amount of DNA (like you’d find at the SOC) into a large amount for testing • Restriction enzymes are used to cut the DNA into fragments at specific sites • Gel Electrophoresis is used to separate the fragments into a pattern called a fingerprint • These fingerprints can be matched to fingerprints from DNA isolated from suspects (usually by mouth swab)

35. DNA STRAND: CTGGCTAGGCTACCATGCCCGTAAAT • Everyone has unique DNA except twins

36. Restriction Enzyme • We will use TA-ase, an imaginary enyzme, to cut our DNA • Sample DNA strand • CTGGCTAGGCTACCATGCCCGTAAAT • CTGGCTA GGCTA CCATGCCCGTA AAT

37. Electrophoresis • Separates fragments by size • Largest fragment travels least

38. Gel electrophoresis separates the resulting fragments by size • – the largest fragment moves the slowest through the gel so it stays up at the top

39. And we get a fingerprint that looks something like this:

40. Fingerprints can then be compared to decide which DNA is which

41. OJ crimes of the century (DNA)

42. http://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_2/DNA_forensics.htmlhttp://www.biology.arizona.edu/human_bio/problem_sets/DNA_forensics_2/DNA_forensics.html • http://www.biologycorner.com/bio4/notes/DNA_fingerprint.php • http://www.dnai.org/index.htm