Sara Oyler-McCance USGS, Fort Collins Science Center, Fort Collins, CO Paul Leberg

1. CONSERVATION GENETICS AND MOLECULAR ECOLOGY IN WILDLIFE MANAGEMENT Sara Oyler-McCance USGS, Fort Collins Science Center, Fort Collins, CO Paul Leberg University of Louisiana at Lafayette, LA

2. Introduction • Genetic techniques have only recently been applied to wildlife studies • Due to technological advances that have made genetic methods straightforward and inexpensive

3. Molecular Genetic Techniques • All techniques examine portions of DNA at some scale • Nuclear genome – biparentally inherited, found in cell nucleus, evolves slowly (yet some regions evolve rapidly) • Mitochondrial genome – maternally inherited, housed in mitochondrion, much smaller than nuclear genome, evolves quickly, well mapped in many species

4. Investigating Genetic Variation • Some techniques consider gene products (e.g. proteins) while others examine variation at the nucleotide level (e.g., DNA sequencing, fragment analysis) • Polymerase Chain Reaction (PCR) – a region of DNA is targeted and amplified exponentially

5. Polymerase Chain Reaction Forward Primer Reverse Primer …………AGCTTAGCTATATG………… AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG AGCTTAGCTATATG …………AGCTTAGCTATATG…………

6. Analysis of Gene Products • Proteins are a series of amino acids joined by peptide bonds • Mutations cause changes in shape, charge, and migration rates in electrophoresis • Variation can be detected among individuals, populations, or species • Can only examine a small proportion of variation present in DNA that codes for proteins

7. Fragment Analysis • Genetic techniques that explore variation indirectly by comparing the size of DNA fragment electrophoretically • Examples include RFLP, AFLP, Minisatellites and microsatellites • The most widely used for wildlife studies are microsatellites

8. Microsatellites • Regions in the nuclear genome characterized by short tandem repeats (e.g., CT repeated 20 times) • PCR based technique that identifies diploid genotypes for specific loci Example of a microsatellite locus. This locus is heterozygous in this individual With 1 allele sized 362 and 1 allele sized 366 base pairs.

9. DNA Sequencing • DNA sequencing involves targeting a certain region of the genome, amplifying it, and reading the DNA sequence in that region Example of DNA sequence

10. Single Nucleotide Polymorphisms • Emerging marker that is a specific site in a DNA sequence in which a single nucleotide varies Individual 1 (A) ATGCGGCGATTGCCATGGGTA Individual 2 (A) ATGCGGCGATTGCCATGGGTA Individual 3 (A) ATGCGGCGATTGCCATGGGTA Individual 4 (B) ATGCGGCCATTGCCATGGGTA Individual 5 (B) ATGCGGCCATTGCCATGGGTA Individual 6 (B) ATGCGGCCATTGCCATGGGTA SNP

11. Applicability of Common Types of Molecular Markers for Wildlife Biologists Number of Xs indicates the relative applicability of each technique to a specific question (modified from Mace et al. 1996).

12. Genetic Sampling • DNA can be extracted from a variety of tissues including muscle, heart, liver, blood, skin, hair, feathers, saliva, feces, urine, scales, bone, fins, eggshell membranes and potentially cervid antlers • Destructive sampling – when an organism is killed during the process of sampling • Nondestructive sampling – when a genetic sample can be obtained without sacrificing the animal

13. Sources of DNA and How Samples Should be Collected

14. Taxonomy • While most taxonomic classes are somewhat arbitrary (subspecies, genera, order) the species classification is perceived to be based on real, evolutionary units • Species definition is integral to the Endangered Species Act • Two most common and applied species concepts are Biological (BSC) and Phylogenetic (PSC) • BSC emphasizes reproductive isolation • PSC uses the criterion of reciprocal monophyly and typically relies solely on genetic data

15. Gunnison sage-grouse were recognized as a new species in 2000 based on differences in morphology, behavior, and genetics. Comparison of greater sage-grouse (left) and Gunnison sage-grouse (right).

16. Hybridization • Genetic methods can be used to document hybridization, introgression, and taxonomic status • Molecular techniques can also be used to determine the maternity and paternity of hybrids

17. Evolutionary Significant Units • Genetic methods can be used to objectively prioritize conservation and management value below the species level • Evolutionary Significant Units (ESU) and Management Units (MU) allow for that prioritization

18. Conservation of Genetic Diversity • Four main forces affect Genetic Diversity Mutation Gene Flow Genetic drift Selection • Understanding these forces can aid in the management of genetic diversity

19. Mutation • Changes in the DNA sequence that result in new genetic variation • Usually management actions have little affect on this process • Mutations can be increased by some environmental contaminants • Mutations are low frequency events and thus have been hard to detect; this is changing with the development of better screening technologies

20. Gene Flow • Results from individuals moving from their natal population to a new one, where they successfully reproduce • Often reported as Nm, the number of migrants per generation, where N is the average size of the populations and m is the migration rate between them. • Gene flow is negatively related to the amount of differentiation observed between populations • Population differentiation is often expressed as the FST , which can be defined as the proportion of the total variance in allele frequencies due to differences among populations

21. Gene Flow • The greater the exchange of individuals between populations the more that genetic similarity of the populations will increase Equilibrium relationship of genetic differentiation among subpopulations (as measured by FST) and number of migrants per generation (modified from Mills and Allendorf 1996).

22. Sex-biased Dispersal • In many wildlife species, one sex tends to disperse to a new area, while the other remains near its natal site • In such species, DNA that is paternally inherited, such as the Y chromosome in mammals, or maternally inherited, such as mtDNA, can have very different patterns of population structure than nuclear markers

23. Gene Flow • Because gene flow is high between most wildlife populations, FST tends to be low • However, even in migratory birds, such as in the golden-cheeked wabler and black-capped vireo, that can move great distances, population differentiation can result from cases of habitat fragmentation (Photographs by Kelly Barr)

24. Habitat Fragmentation • Because fragmentation can lead to genetic differentiation and loss of variation, management often attempts to prevent fragmentation or to reconnect habitat fragments with corridors • In extreme cases, managers may assist migration by moving individuals between fragmented populations • Reintroduction programs, that translocation individuals from sites they are common, to sites they are rare or absent, also can result in gene flow.

25. Genetic Drift • Random changes in the frequencies of alleles • Increases with decreasing population size • Increases genetic differences among small, isolated populations • Gene flow counteracts the influence of drift

26. Genetic Drift • When a normally large population goes through a constriction in size, it is referred to as a genetic bottleneck • During bottlenecks, drift is accelerated • Severe bottlenecks, reducing the size of a population to just a few individuals, can cause the loss of many alleles from a population • Long bottlenecks increase the occurrence of inbreeding in a population

27. Genetic Drift • The rate of loss of variation in a population is to a population’s effective size (Ne) • Ne is often smaller than the number of breeding adults in a population • Ne can be reduced below the census population size by many factors, including unequal sex ratios, temporal differences in population size, and large variation among the number of young produced by the adults in the population

28. Human Activities • A number of human activities can increase drift: • Creation of small populations , through habitat fragmentation and degradation, as well as over harvest • Releasing only a small number of individuals in translocation programs • Creating very skewed sex ratios in game species, by harvesting only one sex

29. Selection • Differential survival and fecundity of genotypes can have complex effects on genetic diversity • Typically, selection plays only a minor role in discussions about of management of genetic diversity • Technological advances are allowing better monitoring of selection in nature • Some harvest practices have been shown to have the potential for producing unintended selective changes in populations

30. Population Viability • Interest in preserving genetic diversity stems from the relationship between genetic diversity and population viability • Small populations that lose genetic diversity due to inbreeding can suffer from inbreeding depression reducing survival and fecundity • Genetic diversity lost via drift is not available for adaptation to changing environmental conditions

31. Captive Breeding Programs • Because most captive populations are small, they are subject to inbreeding and drift • To prevent loss of variation, populations should be established with a large number of unrelated individuals, and be maintained at large population sizes • Efforts should be made to prevent adaptation to captive conditions, so that reintroduction into the wild remains a viable possibility

32. Noninvasive Sampling • As DNA can be extracted from a variety of material, non-invasive sampling allows samples to be collected without handling or disturbing animals • Because each individual has its own unique genetic fingerprint, DNA can be used a unique ‘mark’ for mark and recapture methods

33. Noninvasive Sampling • This type of sampling also can be used to identify species, estimate sex ratios, and provide genetic material for population and landscape genetic studies Baiting a hair snare with cat nip

34. Estimating Population Size and Survival • Requires a set of markers polymorphic enough to distinguish among individuals (microsatellites) • DNA from non-invasively collected samples is low quantity and can be degraded • Contamination is an issue • Allelic dropout can be a problem (when only 1 of 2 alleles of template DNA is amplified, looks like a homozygote when it is a heterozygote)

35. Tracking Individual Movements • As individuals can be uniquely identified with genetic markers, movement data can be obtained by “recapturing” individuals at different times in different locations • Genetic stock identification – when breeding populations differ genetically, it is possible to identify dispersing or migrating individuals

36. Species Identification • Wildlife “sign” such as feces, tufts of hair, feathers, blood and even frozen urine are often found and need to be identified to species • This can be particularly important for monitoring programs that don’t need individual identification but need to confirm the species that left the sign • MtDNA sequencing can be used to identify species

37. Dietary Analysis • Molecular probes can be used to examine food habits (in the absence of recognizable remnants of plant and animal parts) • Such work can be conducted on feces, stomach contents, and bird regurgitate • DNA analysis of scat can trace multiple food items to a given individual and can even be quantified

38. Gender Identification • For some species it is difficult to determine gender without invasive procedures • Gender of the individual who left a wildlife “sign” is often unknown as well but important for survival and population estimates as well as sex ratios • Molecular techniques can easily determine gender

39. Gender Identification • Procedures for mammals and birds are slightly different • In mammals, males are heterogametic sex (X,Y) • In birds, females are heterogametic sex (W,Z) • Both techniques amplify regions on the sex chromosomes

40. SUMMARY • Molecular genetic techniques represent a powerful set of tools for wildlife science • They can be used to identify species and appropriate units for conservation, document effective population sizes, and levels of connectivity among areas • Noninvasive collection of DNA has been used to estimate sex ratios, food habits, population sizes, survival rates, and mating systems • Rapid development of DNA-based technologies will revolutionize wildlife research in the future