1 / 34

Cell Division and Pathogens Pathobiology 552 Denise Galloway dgallowa@fhcrc.org

Cell Division and Pathogens Pathobiology 552 Denise Galloway dgallowa@fhcrc.org. The Cell Cycle Growth arrest vs. apoptosis Telomeres and telomerase Human papillomaviruses and the cell cycle Immortalization and transformation. M- phase Segregation of chromosomes. G1-phase Gap 1.

thiery
Download Presentation

Cell Division and Pathogens Pathobiology 552 Denise Galloway dgallowa@fhcrc.org

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Cell Division and Pathogens Pathobiology 552 Denise Galloway dgallowa@fhcrc.org • The Cell Cycle • Growth arrest vs. apoptosis • Telomeres and telomerase • Human papillomaviruses and the cell cycle • Immortalization and transformation

  2. M- phase Segregation of chromosomes G1-phase Gap 1 G2-phase Gap 2 S – phase Replication of DNA

  3. CYC D CDK 4 M G1 CYC E CDK 2 G2 S CYC A CDK 2 CYC B CDC 2 CYC A CDC 2

  4. Transcription Binding of inhibitor Degradation (PEST, D-box) Cyclin CKI CKI CD Kinase P - T14 Binding of cyclin to CDK Y15 T161 - P Cks Wee1/Myt-1 kinase CDC25 phosphatase CAK (CDK activating kinase)

  5. Control of G1/S Transition CYC D CDK4 p16INK4A (p15, p18, p19) Rb/p107/p130 HDAC CYC E CDK2 E2F p21CIP1 (p27, p57) ARF p53

  6. Ac Ac Ac Ac Ac Ac Ac Ac HDAC HAT X

  7. DNA Damage M G1 p53 p53 G2 S

  8. ATM/p53 Signaling Pathway

  9. ATM/p53 Signaling Pathway ATM Chk2 CDK2 G1 arrest G2 arrest p53 E p21 CDC2 B

  10. S/M Re-rep. G1 S G2 M S G1/S G2/M Spindle G2/M

  11. Oncogenes, Growth factors Redox DNA damage Hypoxia kinases ARF p53 MDM2 p21 Apoptosis Growth arrest

  12. Pathogen infection stimulates apoptosis

  13. Why do cells need telomeres and telomerase? • Linear chromosomes pose 2 problems for cells: • End-replication problem • Distinguishing chromosome ends from ds DNA breaks

  14. The end-replication problem DNA replication 5’ leading strand lagging strand 3’ RNA primer removal and Okazaki fragment ligation 5’ 3’

  15. telomeres Telomeres are protein/DNA protective structures at the ends of chromosomes telomeres 3 ´ G-strand overhang ~ 10 Kb human ~ 40 Kb mouse TTAGGG TTAGGG AATCCC AATCCC Q-FISH to detect TTAGGG (PNA probes)

  16. Telomere-binding proteins Rad50/Mre11/Nbs1 pot-1 tankyrase TRF1 telomerase PARP5 TRF2 Ku tin2 “open” telomere Ku DNA-PKcs Ku TRF2 DNA-PKcs TRF1 “closed” telomere t-loop

  17. Griffith 1999 G strand T-loop 5’ hPOT1 3’ TRF2 C strand TRF1 nucleosomes zoom in on telomere adapted from Neidle and Parkinson (2003) Current Opinion in Structural Biology Telomere structure caps chromosome ends

  18. AAUCCCAA Telomeres and telomerase 3’ Telomerase hTERT hTR CCCAATCCCAATCCC5’ GGGTTAGGGTTAGGGTTAGGGTTAGGGTT3’ 10-15 Kb ds telomeric DNA ~200 nt ss 3’ overhang

  19. AAUCCCAA Regulation of telomerase expression Primarily by regulating expression of the hTERT catalytic subunit hTERT The hTERT and hTR components are sufficient for in vitro activity. Kilian 1997, Meyerson 1997, Nakamura 1997 Expression of hTERT subunit is sufficient to induce telomerase activity in many different cell types. Bodnar 1998, Counter 1998, Vaziri and Benchimol 1998 While most somatic cells do not express hTERT, stem cells, germ cells, and tumor cells DO express hTERT. Kim 1994,Sharma 1995,Chiu 1996, Kolquist 1998

  20. Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac CpG Island TSA treatment to inhibit histone deacetylases induces telomerase activity in some cell types Cong 2000, Takakura 2001, Hou 2002  Chromatin modifications may play a key role in activity No correlation of DNA methylation with transcriptional activity of the promoter Regulation of hTERT expression

  21. DNA Tumor Virus Oncoproteins SV40 Large T antigen Rb, p53 Small T pp2A Ad E1A Rb E1B p53 HPV E6 p53, hTert E7 Rb

  22. The human papillomavirus Viral oncogenes E6 LCR E7 HPV ~8000 bp L1 E1 Transcriptional control and viral DNA replication E2 Viral capsid proteins L2 E4 E5

  23. Expression of viral genes in the stratified epithelium Virus release Late gene expression and capsid formation           Squamous Early gene expression and viral DNA replication Supra- basal HPV infects basal cells Basal Basement membrane Infected epithelium Normal epithelium

  24. RB p107, p130 Mi-2 p21, p27 E7 TBP Acid α-gluc M2 PK S4 ATPase c-jun, junB, junD, c-fos RB p107, p130 Ub. RB p107, p130 E2F E7 E2F

  25. Ub Ub (E3 Ub. ligase) E6-AP p53 E6 CBP/p300 hScribble ERC55 GAP pax. tyk2 MAGI E6 hDLG bax IRF3 Mupp1 MCM7 bak PKN Activates transcription Represses transcription Activates telomerase in epithelial cells

  26. E6 E6-AP induces telomerase activity E6 p53 AAUCCCAA Targets of the E6 and E7 oncoproteins E7 Rb E2F S phase genes E2F S phase genes

  27. Regulation of the G1/S transition CYC D CDK4 p16INK4A (p15, p18, p19) E7 E7 E7 Rb/p107/p130 PcG HDAC CYC E CDK2 p21CIP1 (p27, p57) E2F E6 E6 E6 E6 ? p53 MDM2 ARF

  28. Myc Max Working Model for regulation of the hTERT Promoter in Normal HFKs Sin3A HDAC NFX1 -91 TERT E E X

  29. Myc Myc Max Max Working Model for E6 Activation of hTERT ? ? ? HAT HAT NFX1-123 Ac Ac Ac Ac TERT E E X Ac Ac Ac Ac E6 NFX1-91 E6AP

  30. HPV-16 E6 and E7 can efficiently immortalize epithelial cells + E6 + E7 + E6 or E7 Population doublings Senescence Days in culture

  31. + Telomerase AND Loss of Rb/p16 + Telomerase OR Loss of Rb/p16 Induction of telomerase and loss of Rb/p16 pathway are required for immortalization of epithelial cells Population doublings Senescence Days in culture

  32. HPV E7 Inactivation of Rb/p16/cyclin D HPV E6 Inactivation of p53/p21/ATM Block apoptosis Activation of telomerase Activation of genes for invasion, metastasis, angiogenesis

More Related