1 / 18

Mapping in Arabidopsis

Mapping in Arabidopsis. Jeff Long Salk Institute. Cotyledons (seed leaves). Shoot Apical Meristem. Hypocotyl (seedling stem). Root. Root Apical Meristem. tpl-1. tpl-1. tpl-1. monocot. tube. pin. tpl-1 mutant phenotypes. One way to learn about development is by examining mutants.

thomas-mullen
Download Presentation

Mapping in Arabidopsis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mapping in Arabidopsis Jeff Long Salk Institute

  2. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem

  3. tpl-1 tpl-1 tpl-1 monocot tube pin tpl-1 mutant phenotypes One way to learn about development is by examining mutants WT

  4. Mutagens that create base pair changes EMS, Gamma Rays, Others One way to learn about development is by examining mutants How does one generate mutants? T-DNA mutagenesis Problem-How do you identify the mutated gene from the other 25,000 found in the genome?

  5. The answer is by mapping! In Arabidopsis we can take advantage of DNA differences between different strains or ecotypes. What is an ecotype?

  6. An ecotype is just another strain of Arabidopsis that has been geographically isolated

  7. Different ecotypes often contain differences in their DNA These differences can destroy or create new restriction sites Known as restriction fragment length polymorphisms or RFLP’s These RFLP’s can be tracked either by Southern blotting or PCR followed by digestion

  8. EcoR1 Col CCAAGCTGAATTCTTCGAAT Ler CCAAGCTGTATTCTTCGAAT Sequence differences can be found between ecotypes promoter coding

  9. Ler Ler Col Col Ler Col

  10. Can use PCR primers to track these changes=markers DNA changes can also cause insertions/deletions-Indels The example below is a simple sequence length polymorphism-SSLP’s Ler Col

  11. Indels can be tracked by PCR with no digestion

  12. Mapping strategy Cross your mutant to a different ecotype (our case mutant is in Landsberg erecta and different ecotype is Columbia) Allow the F1 population to self after meiosis (where recombination will take place) Isolate DNA from resulting F2 mutant plants- use DNA differences between ecotypes to map

  13. F1 plant F2 gametes

  14. F2 chromosomes mutant marker 1 marker 2 Mutant Xdifferent ecotype Self F1 plants Select mutant F2 plants for mapping

  15. Ler Col 9/10 Ler Col Ler 5/12 Ler F2 chromosomes By picking homozygous mutants, you know the ecotype at the mutant locus mutant Markers close to your gene will show a bias toward the original ecotype Referred to as linkage marker 1 marker 2

  16. monocot Isolate DNA from tpl-1 mapping population tpl-1

More Related