Lecture 3: Allele Frequencies and Hardy-Weinberg Equilibrium

1. Lecture 3: Allele Frequencies and Hardy-Weinberg Equilibrium January 13, 2014

2. Last Time • Review of genetic variation and Mendelian Genetics • Methods for detecting variation • Morphology • Allozymes • DNA Markers • Anonymous • Sequence-tagged

3. Today • Sequence probability calculation • Molecular markers: DNA sequencing • Introduction to statistical distributions • Estimating allele frequencies • Introduction to Hardy-Weinberg Equilibrium • Using Hardy-Weinberg: Estimating allele frequencies for dominant loci

4. If nucleotides occur randomly in a genome, which sequence should occur more frequently? AGTTCAGAGT AGTTCAGAGTAACTGATGCT What is the expected probability of each sequence to occur once? How many times would each sequence be expected to occur by chance in a 100 Mb genome?

5. What is the expected probability of each sequence to occur once? AGTTCAGAGT What is the sample space for the first position? A T G C Probability of “A” at that position? Probability of “A” at position 1, “G” at position 2, “T” at position 3, etc.? AGTTCAGAGTAACTGATGCT

6. How many times would each sequence be expected to occur in a 100 Mb genome? AGTTCAGAGT AGTTCAGAGTAACTGATGCT Why is this calculation wrong?

7. AGTTCAGAGTAACTGATGCT A B AGT TCA GAG TAA CTG ATG CT UCA AGU CUC AUU GAC UAC GA Ser Cys Phe Ile Asp Tyr UGA AGU CUC AUU GAC UAG GA Stop Cys Phe Ile Asp Stop

8. DNA Sequencing • Direct determination of sequence of bases at a location in the genome • Shotgun versus PCR sequencing • Dye terminators (Sanger) and capillaries revolutionized DNA sequencing • Modern sequencing methods (sequencing by synthesis, pyrosequencing) have catapulted sequencing into realm of population genetics • Human genome took 10 years to sequence originally, and hundreds of millions of dollars • Now we can do it in a week for <$2,000

9. SNPs • A Single Nucleotide Polymorphism (SNP) is a single base mutation in DNA. • The most common source of genetic polymorphism (e.g., 90% of all human DNA polymorphisms). • Identify SNP by screening a sample of individuals from study population: usually 16 to 48 • Once identified, SNP are assayed in populations using high-throughput methods

10. Genotyping by Sequencing • New sequencing methods generate 10’s of millions of short sequences per run • Combine restriction digests with sequencing and pooling to genotype thousands of markers covering genome at very high density Cut Sites Presence-Absence Polymorphism SNP Illumina Sequencing Library Construction Generate 10’s of thousands of markers for <$100 per sample http://www.maizegenetics.net/images/stories/GBS_CSSA_101102sem.pdf

11. Genotyping by Sequencing Cost Example http://www.maizegenetics.net/gbs-overview

12. 2 sd Expected Value (Mean): 1 sd where n is the number of samples Variance (Vx): A measure of the dispersion around the mean: Standard Deviation (sd): A measure of dispersion around the mean that is on same scale as mean Statistical Distributions: Normal Distribution • Many types of estimates follow normal distribution • Can be visualized as a frequency distribution (histogram) • Can interpret as a probability density function

13. Standard Error of the Mean (se): 95% Confidence Interval: Standard Error of Mean • Standard Deviation is a measure of how individual points differ from the mean estimates in a single sample • Standard Error is a measure of how much the estimate differs from the true parameter value (in the case of means, μ) • If you repeated the experiment, how close would you expect the mean estimate to be to your previous estimate?

14. Estimating Allele Frequencies, Codominant Loci • Measured allele frequency is maximum likelihood estimator of the true frequency of the allele in the population (See Hedrick, pp 82-83 for derivation) • Expected number of observations of allele A1: E(Y)=np • Where n is number of samples • For diploid organisms, n = 2N , where N is number of individuals sampled • Expected number of observations of allele A1is analogous to the mean of a sample from a normal distribution • Allele frequency can also be interpreted as an estimate of the mean

15. Frequency of A2 = q Frequency of A1 = p Allele Frequency Example • Assume a population of Mountain Laurel (Kalmia latifolia) at Cooper’s Rock, WV A1A1 A1A2 A2A2 Red buds: 5000 Pink buds: 3000 White buds: 2000 • Phenotype is determined by a single, codominant locus: Anthocyanin • What is frequency of “red” alleles (A1), and “white” alleles (A2)?

16. Number of ways of observing y positive results in n trials Allele Frequencies are Distributed as Binomials • Based on samples from a population • For two-allele system, each sample is like a “trial” • Does the individual contain Allele A1? • Remember, q=1-p, so only one parameter is estimated • Binomials are variables that can be interpreted as the number of successes and failures in a series of trials where s is the probability of a success, and f is the probability of a failure Probability of observing y positive results in n trials once

17. Given the allele frequencies that you calculated earlier for Cooper’s Rock Kalmia latifolia, what is the probability of observing two “white” alleles in a sample of two plants?

18. Variation in Allele Frequencies, Codominant Loci • Binomial variance is pq or p(1-p) • Variance in number of observations of A1: V(Y) = np(1-p) • Variance in allele frequency estimates (codominant, diploid): • Standard Error of allele frequency estimates: • Notice that estimates get better as sample size increases • Notice also that variance is maximum at intermediate allele frequencies

19. Maximum variance as a function of allele frequency for a codominant locus

20. p = 0.5 p = 0.125 Why is variance highest at intermediate allele frequencies? If this were a target, how variable would your outcome be in each case (red versus white hits)? Variance is constrained when value approaches limits (0 or 1)

21. What if there are more than 2 alleles? • General formula for calculating allele frequencies in multiallelic system with codominant alleles: • Variance and Standard Error of allele frequency estimates remain:

22. Codominant Codominant locus locus Dominant locus Dominant locus - - A1A1 A1A2 A2A2 A2A2 A1A1 A1A2 + + How do we estimate allele frequencies for dominant loci?

23. Frequency of A1A1 (P) Frequency of A1A2 (H) Frequency of A2A2 (Q) Hardy-Weinberg Law • After one generation of random mating, single-locus genotype frequencies can be represented by a binomial (with 2 alleles) or a multinomial function of allele frequencies