1 / 16

Horspool Algorithm

Horspool Algorithm. Source : Practical fast searching in strings R. NIGEL HORSPOOL Advisor: Prof. R. C. T. Lee Speaker: H. M. Chen. Text. Pattern. Definition of String Matching Problem.

topper
Download Presentation

Horspool Algorithm

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Horspool Algorithm Source : Practical fast searching in strings R. NIGEL HORSPOOL Advisor: Prof. R. C. T. Lee Speaker: H. M. Chen

  2. Text Pattern Definition of String Matching Problem • Given a pattern string P of length m and a text string T of length n, we would like to know whether there exists an occurrence of P in T.

  3. Rule 2: Character Matching Rule • For any character X in T, find the nearest X in P which is to the left of X in T.

  4. Suffix search Text α ß Pattern σ match • For each position of the window, we compare its last character(ß) with the last character of the pattern. • If they match, we scan the window backwardly against the pattern until we either find the pattern or fail on a text character.

  5. Suffix search Text ß Text α ß ß Safe shift Pattern σ no ß in this part match • Then, no matter whether there is a match or not, we shift the window so that the pattern matches ß. Note that ß is the last character of the previous window.

  6. Preprocessing phase HpBc table The value bmBc for a particular alphabet is defined as the rightmost position of that character in the pattern – 1. Example : T : GCATCGCAGAGAGTATACAGTACG P : GCAGAGAG 7 6 5 4 3 2 1

  7. Pseudo code Horspool (P = p1p2…pm,T = t1t2…tn) Preprocessing For c ∑ Do d[c] ← m For j  1…m-1 Do d[pj] ← m - j Searching pos←0 While pos ≤ n-m Do j ←m While j > 0 And tpos+j = pj Do j ← j-1 If j = 0 Then report an occurrence at pos+1 pos ← pos +d[tpos+m] End of while

  8. Preprocessing phase Step1: For c ∑ Do d[c] ← m c  {A C G T} d[A]=8 , d[C]=8 d[G]=8 , d[T]=8 for example : T : GCATCGCAGAGAGTATACAGTACG P : GCAGAGAG Step2: For j 1…m-1 Do d[pj] ← m – j d[A]=1 , d[C]=6 d[G]=2 , d[T]=8

  9. Example(1/3) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 GCATCGCAGAGAGTATACAGTACG  GCAGAGAG pos ← 0 + d[t0+7] , pos ← 0 + d[A], pos ← 1 GCATCGCAGAGAGTATACAGTACG  GCAGAGAG pos ← 1+ d[t1+7] , pos ← 1+ d[G], pos ← 3 GCATCGCAGAGAGTATACAGTACG GCAGAGAG pos ← 3+ d[t3+7] , pos ← 3 + d[G], pos ← 5 pos ← pos +d[tpos+m] A C G * 1 6 2 8

  10. Example(2/3) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 GCATCGCAGAGAGTATACAGTACG  GCAGAGAG While j > 0 And tpos+j = pj Do j ← j-1 If j = 0 Then report an occurrence at pos+1 pos ← 5+ d[t5+7] , pos ← 5+ d[G], pos ← 7 GCATCGCAGAGAGTATACAGTACG  GCAGAGAG pos ← 7+ d[t7+7] , pos ← 7+ d[A], pos ← 8 GCATCGCAGAGAGTATACAGTACG  GCAGAGAG pos ← 8+ d[t8+7] , pos ← 8+ d[T], pos ← 16 A C G * 1 6 2 8

  11. Example(3/3) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 GCATCGCAGAGAGTATACAGTACG GCAGAGAG pos ← 16+ d[t16+7] , pos ← 16+ d[G], pos ← 18 pos > n-m // pos >23-7 jump out of while loop A C G * 1 6 2 8

  12. Example(1/2) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 AGATACGATATATAC  ATATA d[A] = 2 AGATACGATATATAC  ATATA G ≠A,d[G] = 5 for example : T : AGATACGATATATAC P : ATATA

  13. Example(2/2) 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 AGATACGATATATAC  ATATA We verify backward the window and find the occurrence. We then shift by re-using the last character of the window, d[A] = 2 AGATACGATATATAC ATATA We find the pattern. We shift by the last character of then window, d[A] = 2. Then, pos > n-m and the search stops. A T * 2 1 5

  14. Time complexity • preprocessing phase in O(m+ п) time and O(п) space complexity. • searching phase in O(mn) time complexity. • the average number of comparisons for one text character is between 1/п and 2/(п+1). (п is the number of storing characters)

  15. References • AHO, A.V., 1990, Algorithms for finding patterns in strings. in Handbook of Theoretical Computer Science, Volume A, Algorithms and complexity, J. van Leeuwen ed., Chapter 5, pp 255-300, Elsevier, Amsterdam. • BAEZA-YATES, R.A., RÉGNIER, M., 1992, Average running time of the Boyer-Moore-Horspool algorithm, Theoretical Computer Science 92(1):19-31. • BEAUQUIER, D., BERSTEL, J., CHRÉTIENNE, P., 1992, Éléments d'algorithmique, Chapter 10, pp 337-377, Masson, Paris. • CROCHEMORE, M., HANCART, C., 1999, Pattern Matching in Strings, in Algorithms and Theory of Computation Handbook, M.J. Atallah ed., Chapter 11, pp 11-1--11-28, CRC Press Inc., Boca Raton, FL. • HANCART, C., 1993. Analyse exacte et en moyenne d'algorithmes de recherche d'un motif dans un texte, Ph. D. Thesis, University Paris 7, France. • HORSPOOL R.N., 1980, Practical fast searching in strings, Software - Practice & Experience, 10(6):501-506. • LECROQ, T., 1995, Experimental results on string matching algorithms, Software - Practice & Experience 25(7):727-765. • STEPHEN, G.A., 1994, String Searching Algorithms, World Scientific.

  16. THANK YOU

More Related