1 / 26

Breaking Barriers: getting biologists involved in everyday data integration using Moby

Breaking Barriers: getting biologists involved in everyday data integration using Moby. Paul Gordon Genome Canada Bioinformatics Platform University of Calgary, Canada. Outline. concept, usage, future Getting Biologists Involved: Seahawk &. DNASequence. NCBI_gi.

torgny
Download Presentation

Breaking Barriers: getting biologists involved in everyday data integration using Moby

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Breaking Barriers:getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of Calgary, Canada

  2. Outline • concept, usage, future • Getting Biologists Involved: Seahawk &

  3. DNASequence NCBI_gi Sequence_Alignment

  4. Core Moby Service Providers in Europe

  5. Founding partner

  6. SADI In A Nutshell

  7. As OWL AxiomsHomologousMutantImage is owl:equivalentTo { Gene Q hasImage image P Gene Q hasSequence Sequence Q Gene R hasSequence Sequence R Sequence Q similarTo Sequence R Gene R = “my gene of interest” }

  8. Mobify the World.

  9. Paul’s Maxims • You cannot get rid of work • You can: • Distribute work amongst parties with vested interests & required capabilities • Avoid redoing the same work repeatedly

  10. Agenda • Motivation • Audience • Mechanism

  11. Larry Wall’s “Virtues of a Programmer” HUBRIS IMPATIENCE LAZINESS

  12. Audience Willing to take training Capable but no hubris Taverna self-starters Amoeba God Self-perception of computer skills

  13. Man’s Prayer Bioinformatician • I’m a man… • But I can change… • If I have to… • I guess…

  14. Take the output of the U of C service and send it to iHOP, then send its output to DDBJ’s service…

  15. myGRID RDF

  16. Semantic Annotations for WSDL Moby SAWSDL

  17. bioxml.info

  18. MOB Rule Syntax >gi|12434353 glycerol kinase cgatcagcatcgactagcatcgactatttgctatcat cagctacgatcagctacgactac…

  19. Shared Responsibility • Service Providers • Proxy Provider • Third Party Developers • Biologists Tu deviens responsable pour toujours de ce que tu as apprivoisé.

  20. SAWSDL Required Infrastructure Calgary Anywhere Compute Cloud (e.g. Calgary or Google App Engine) Anywhere Calgary (Sun v240)

  21. To Do • Formal user studies • HTML Form wrapping • Enactment portal • Biocatalogue? If you can not measure it, you can not improve it. – Lord Kelvin

  22. Acknowledgements

More Related