Chapters 12 & 13

1. Chapters 12 & 13 Transcription and Translation Note- we’ll cover 11 later!

2. Where we’re going • Transcription: major players, pro and euk differences (story) • Translation: major part of the process • Protein structure covered briefly- primary, secondary, tertiary, and some new terms. • Ch 12’s laid out weird- we’ll cover things in more of a traditional fashion

3. DNA makes RNA makes protein- Central -------------- Of molecular genetics

4. Prokaryotic & Eukaryotic Transcription: DNA---->RNA • I. What: making an RNA “copy” of one strand of DNA: • (template, anticoding, antisense strand) 3'ATCGCCTAGCCGTTAGGG5' • 5'TAGCGGATCGGCAATCCC3' • (partner, coding, sense strand) • transcription • 5'UAGCGGAUCGGCAAUCCC3' • II. Importance: • A. Link to Translation; • B. Gene regulation: genes are turned on and off mainly by transcription.

5. III. Main player(s): RNA polymerases: enzymes that cause transcription. • components: (prokaryote- eukaryotes MUCH more complicated) • core: α,αβ,β’ Core: non-specific binding to DNA and transcription of nicked DNA. • --------- • α,αβ,β’; σ • Holoenzyme: • Core + σ (holoenzyme): specific transcription from promoters

7. Initiation, Elongation, Termination: • Initiation: • Loose binding to DNA (not at promoter) • Binding to promoter (closed promoter); helix is unwound • tight binding to promoter (open promoter- the DNA is opened!) Note that open is tighter than closed! • First base added, complementary to the anticoding strand. • Many promoters have been sequenced: • -35 -10 -1|1 • ======TTGACa=========TAtAaT====AorG======= upstream (purine) downstream

9. Promoter strength: strong and weak promoters, up and down mutations. Simple control over expression. • Elongation: more bases added to the chain, using the anticoding strand as the template. Goes @ 50 nucleotides/sec. • Termination: Termination signals- poly U + hairpin loop: • 5'TACGAATTCGTATTTTTTTTTTT3' • 3'ATGCTTAAGCATAAAAAAAAA5' transcript forms a “hairpin”: • ------------------ • 5'UACGAAUUCGUAUUUUUUUUUUU3' • 3'AUGCUU|

10. The hairpin seems to dislodge the RNA pol; some terminators aided by protein rho.

11. Hi everybody • OK let’s try that again • HI EVERYBODY!!!! • I HAVEN’T finished grading your quizzes  • Also, EXAM I is a week from Friday    • Oops- a week from Friday! 

12. Pro-Eu differences • Polycistronic- Prokaryotic • Coupled transcription and translation • Monocistronic- Eukaryotic • Can’t couple transcription and translation

13. Replication vs Transcription

14. Transcription in Eukaryotes • Three RNA polymerases • Transcription factors • Caps, tails, splicing

15. three separate RNA polymerases, • I- most rRNA; • II- mRNA; • III- 5S rRNA, tRNA

16. A LOT more complicated at the start! • Upstream regulatory sequences- TATA boxes, CAAT boxes, enhancers- cis acting elements- need to be on the same piece of DNA to have an effect. • transcription factors: LOTS of stuff needs to be at the promoter, to get things started! These are needed for the proper binding of the RNA polymerase to the promoter.trans acting. • More cool videos at the DNA replication site on transcription. • http://www.wehi.edu.au/education/wehi-tv/dna/replication.html • http://www.wehi.edu.au/education/wehitv/dna_central_dogma_part_1_-_transcription/

18. The introns are usually hundreds-thousands of bases Primary transcript Then splicing

19. Splicing: MAJOR difference between pro and euk. • Process: snRNPs (snurps) recognize the borders of an intron: • Exon / intron /Exon • 5'-------cAG/GUaAGU------YnNAG/G------------------3' • a g • Y=9 pyrimidines (C/U); lariats are formed! • The process: fig 12-13: SNRNPs bind at the 5’ and branch point, catalyze the splicing, resulting in 2 exons ligated and a lariat-shaped intron.

22. Here’s a web site that’s got a good illustration of splicing:http://www.web-books.com/MoBio/Free/Ch5A4.htm

23. Things to Know: • the process of transcription- tell the story of initiation, elongation, termination, with the players involved: • RNA polymerase (core, holo, sigma factor), promoters, (open and closed promoter complexes), termination sequences, rho, strong & weak promoters. • Pro and euk. Differences: monocistronic and polycistronic mRNA • Replication& transcription differences  • cis and trans acting elements- examples. • Eukaryotic transcription: Pol I, II, III • Cis & trans elements, transcription factors, enhancers, caps, splicing (tell the story), tails, SNRNP’s. • Number of polymerases; use of transcription factors; presence of enhancers; requirement for transport; processing after transcription.   What are the products of the splicing reaction?

24. Quiz on Friday • Central Dogma • Language of transcription: promoter, enhancer, cis, trans acting, • Pro and Eu differences • Meiosis may show up- seg/independent assortment and meiosis

25. Chapter 13- translation Actually, back to the start of 12- the dogma

26. Key points about the code: • read as triplet codons. • unambiguous: each triplet stands for only one AA • degenerate: more than one codon can code for any particular AA • It has start and stop signals, but no internal punctuation (“commaless”). • (usually) non-overlapping- in theory, you could get three proteins (six, if you read it in both directions!) out of an RNA sequence, but you usually don’t- some minor exceptions in bacterial viruses. • code is mostly universal, with a few exceptions.

27. Bring your laptop to lab tomorrow! • Also- quiz tomorrow- Mendel, Chi-square, etc. • The worksheet’s also due tomorrow.

28. Starting met; stopping: stop codons It’s a one in a million code!

29. Quiz- • Central dogma • Basic terms- promoter, enhancer, exon, intron • Pro& eu differences- caps, tails, splicing

30. Wobble (may be optional) We don’t use 61 different tRNAs The third position of the tRNA can “wobble”, allowing for odd base-pairing. U pairs with A or G I pairs with A, U or G

31. Translation and proteins. • We’re going to cover some of the basics of translation, and then some of the results, in terms of proteins and their modifications. • The key players: the mRNA, the ribosome, and the tRNA and the amino acids. We’ve just looked at the mRNA, so let’s look at the other two:

32. Svedberg unit

33. rRNA’s: are mostly on one transcript that’s processed, not spliced. • They are found in multiple copies, up to 500 in a frog, and more in frog eggs- you need multiple copies to make all the copies needed in a typical cell (10K in a bacterial cell, over 10 million in one of your liver cells!). Like the cool picture at the start of CH 12- we make massive amounts of rRNA! Most of the segments are on a single transcript, which are then processed into smaller pieces

36. Transfer RNA • Important parts: 1) the anticodon: already. • 2) the 3' end and acceptor stem: • aminoacyl‑tRNA synthetase that does this(13-5). It costs one ATP (used to charge the COOH, making a hi‑energy bond), and results in a charged . • tRNA. There is a single aminoacyl‑tRNA synthetase for each amino acid. The specificity of each is in its ability to recognize certain sequences in the acceptor stem. These enzymes are important: a mutation in one of these would cause a global change in the genetic code! It would be like a global find and replace in a document.

39. Translation: Figs 14-6,7. Once again, you have initiation, elongation, and termination: • Initiation: In prokaryotes, there is a sequence at the 5' end that is untranslated, and allows binding of the ribosome‑ ribosome binding site. • Elongation:

43. The Klug/Cummings web site has a good animation www.prenhall.com/klug • Another good animation, on a bunch of stuff:   • http://vcell.ndsu.nodak.edu/animations/home.htm

44. Protein Structure • Primary – AA sequence • Secondary structure- alpha helix, beta sheet • Tertiary structure- 3D shape- Function! • Quaternary- protein-protein interactions