Carlson, Pace & Proliferation of Biological Technologies , Biosec. & Bioterror. 1(3) :1 (2003)

1. Carlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror.1(3):1 (2003)

2. Struggle, Limited Success, Struggle… Devices? System?? Design & Fabrication Application

3. Struggle, Success, Predictable Success Applications Systems Parts & Fabrication Design

4. Enabling Biological Engineering • Decoupling • Rules insulating design process from details of fabrication • Enable parts, device, and system designers to work together • VLSI electronics, 1970s • Standardization • Predictable performance • Off-the-shelf • ME, 1800s • Abstraction • Insulate relevant characteristics from overwhelming detail • Simple artifacts that can be used in combination • From Physics to EE, 1800s

5. Abstraction Systems Devices Parts

6. Parts Zif268, Paveltich & Pabo c. 1991

7. CI LacI Devices CI LacI RBS l cI-857 OLac T

8. Devices LacI  CI inverter LacI CI

9. Systems Inverter.1 Inverter.2 Inverter.3

10. Zif268, Paveltich & Pabo c. 1991 Interfaces Systems Inv.1 Inv.2 Inv.3 LacI  CI inverter LacI CI Devices Parts

11. Zif268, Paveltich & Pabo c. 1991 Parts/Device Interface LacI  CI inverter LacI CI Devices Parts

12. Stories “In 1910, I was in Mexico, in the state of Yucatan, when an invasion of locusts occured; the Indians reported to me that in a certain place the ground was strewn with the corpses of these insects. I went there and collected sick locusts, easily picked out since their principal symptom was an abundant blackish diarrhoea. This malady had not as yet been described, so I studied it. It was a septicaemia with intestinal symptoms, It was caused by bacteria, the locust coccobacilli, which were present almost in the pure state in the diarrhoeal liquid. I could start epidemics in columns of healthy insects by dusting cultures of the coccobacillus on plants in front of the advancing columns: the insects infected themselves as they devoured the soiled plants… In the course of these researches, at various times I noticed an anomaly, shown by some cultures of the coccocacillus which intrigued me greatly, although in fact the observation was ordinary enough, so banal indeed that many bacteriologists had certainly made it before on a variety of cultures. The anomaly consisted of clear spots, quite circular, two or three millimeters in diameter, speckling the cultures grown on agar.” From The Bacteriophage by Dr. Felix d'Herelle, Science News 14: 44-59 (1949). (Translation by J. L. Crammer)

13. A  B inverter A B Zif268, Paveltich & Pabo c. 1991 Parts/Device Interface LacI  CI inverter LacI CI Devices X X Parts

14. A  B inverter C  D inverter E  F inverter A C E B D F Device/System Interface Inv.1 Inv.2 Inv.3 Systems Devices

15. E  F inverter A  B inverter C  D inverter A E C D B F Device/System Interface X A  B E  F C  D X X Systems Devices

16. C  D inverter E  F inverter A  B inverter E C A F D B Device/System Interface A  D A  B E  F C  D X X Systems X Devices

17. cI LacI cI PoPSin RBS l cI-857 OLac T RBS l cI-857 Ol T PoPSout cI PoPSout PoPSin LacI Device/System Interface

18. PoPSOUT PoPSIN cI T RBS l cI Ol Polymerase Per Second = PoPS! T RBS l cI Ol

19. PoPSOUT PoPSOUT PoPSIN PoPS Source (Any) INVERTER PoPSOUT PoPSIN Polymerase Per Second = PoPS! PoPSOUT PoPSIN T RBS l cI Ol cI

20. A  B inverter C  D inverter E  F inverter A C E B D F Device/System Interface Systems X Devices

21. A B C Device/System Interface Systems X A PoPSOUT Devices PoPSIN B PoPSOUT PoPSIN C PoPSOUT PoPSIN

22. Systems PoPS NOT.1 PoPS NOT.2 PoPS NOT.3 ‘Can I have three inverters?’ ‘Here’s a set of PDP inverters, 1N, that each send and receive via a fungible signal carrier, PoPS.’ PoPS NOT.1 Devices PoPS PoPS ‘I need a few DNA binding proteins.’ ‘Here’s a set of DNA binding proteins, 1N, that each recognize a unique cognate DNA site, choose any.’ Parts ‘Get me this DNA.’ DNA ‘Here’s your DNA.’ TAATACGACTCACTATAGGGAGA Zif268, Paveltich & Pabo c. 1991

23. Device-Level System Diagram

24. Parts- and Device-Level System Diagram

25. DNA Layout

26. Characterization and Debug Trigger Test Circuit

27. Registry of Standard Biological Parts http://parts.mit.edu/

28. From: XXXX Subject: Endy Letter Date: January 6, 2005 9:45:17 AM EST To: endy@mit.edu Dr. Endy, I am a sophomore at XXXXX High School in Connecticut and have recently taken an interest in Synthetic Biology.I am writing to ask for your help because i am having difficulty in obtaining information,and understanding some of the information i already have. Anything you can send my way would be greatly appreciated… …I will soon begin working on a proposal to create a BioBrick, any information you can send me on their creation would be excellent. -Sincerely, XXXX XXXX XXXX High School -Grade 10

29. Education Driving Research

30. A Constructive Society

31. UT 2004 SB Competition Team c/o Jeff Tabor

32. UT 2004 SB Competition Team Light  PoPS Receiver BBa_I15010 BBa_R0082 Photons PoPS  Color Converter BBa_B0034 BBa_E0033 BBa_B0015 PoPS c/o Jeff Tabor

33. UT 2004 SB Competition Team Lens ripped off of overhead projector Pile of cells/agar Casserole dish Thermostable chassis c/o Jeff Tabor

34. UT 2004 SB Competition Team c/o Jeff Tabor