The Origin and Evolution of SARS

1. The Origin and Evolution of SARS Yi Guan Dept. of Microbiology, Faculty of Medicine, The University of Hong Kong The First Affiliated Hospital, Guangzhou Med. College Shenzhen C.D.C. Guangdong Province NIAID, Grant A195357 SARS FUNDS, Univ. of Hong Kong HKU, HK SAR, P.R. China; Sept 30, 2003

2. HKU, HK SAR, P.R. China; Sept 30, 2003 Hypothetical Birthplace of SARS

3. 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province Hong Kong

4. 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province Hong Kong The First SARS case was recognized on Nov. 16, 2002

5. 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province Hong Kong On Dec 17, 2002, SARS case was observed in the second city. 11 cases were recorded, 8 of them are medical staff

6. 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province Hong Kong The first SARS case in Zhongshan was reported on Dec. 26, 2002. Total 28 cases were clinically recognized. 13 of them are medical staff who had direct contact history with SARS patients.

7. HKU, HK SAR, P.R. China; Sept 30, 2003

8. HKU, HK SAR, P.R. China; Sept 30, 2003 Investigation Conclusion 1. Outbreak of atypical pneumonia (unidentified infectious agent, most likely viral infection) 2. Infectious Disease, with family and hospital clustered (incubation about 4 days, 1-11days) 3. Documented Diagnosis definition, Treatment and Prevention principles 4. Suggest to set up case report system Jan. 21, 2003 Zhong-Shan outbreak

9. 100 miles HKU, HK SAR, P.R. China; Sept 30, 2003 Guangdong Province Hong Kong The first community SARS case in Guangzhou was reported on Jan.31, 2003.

10. The First “Super-Infectious” case--- >100 cases • Visited Zhongshan and got onset there • Jan 31, 03: admitted to The 2nd Affiliate Hospital at the afternoon, • <24 hours, > 30 medical staffs infected • Feb 1, 03 - Feb 8, 03: transferred into The 3rd Affiliated Hospital, • within those 8 days, 26 medical staffs got infected. • Feb 8, 03: transferred into Guangzhou Infectious Disease Hospital. • Family members and relatives of the patient also got infected (19). HKU, HK SAR, P.R. China; Sept 30, 2003

11. Nov 16, 02 - Feb 9, 03: 305 SARS cases reported, 5 people were killed by the disease in Guangdong No. of case Outbreak time City Jan. 31, 2003 Dec. 26, 2002 Nov. 16, 2002 Nil Dec. 17, 2002 Nil 226 28 19 15 11 6 305 Guangzhou Zhongshan Foshan Jiangmen Heyuen Shenzhen Total HKU, HK SAR, P.R. China; Sept 30, 2003

12. No. of reported cases of Guangdong Peak time of outbreak is on Feb. 9, 50 cases/day Feb. 12, 03 30 new cases Feb. 19, 03 5 new cases HKU, HK SAR, P.R. China; Sept 30, 2003

13. HKU, HK SAR, P.R. China; Sept 30, 2003 HKU started to initiate the investigation in Guangdong as early as on Feb 11, 03. One Big Question: Whether H5N1 bird flu get into humans, like 1997 incident? On Feb 12, 03, we got 18 patients’ samples On Feb 18, 03, we got 22 patients’ samples

14. Preliminary results • The major efforts were focused on to • isolate H5N1 influenza virus • We did isolate H5N1 influenza virus from Hong Kong family, and one from Guangzhou atypical pneumonia case • We failed to isolate coronavirus earlier, but do benefit to the coming investigation in HK, i.e. our response system started to run before the case got into HK (setting up a lab in Guangzhou)

15. HKU, HK SAR, P.R. China; Sept 30, 2003 Isolation of coronavirus by FrHK4 cell cultures GZ43 GZ50 GZ60 Doctor Clerk Nurse

16. HKU, HK SAR, P.R. China; Sept 30, 2003 A C B D

17. HKU, HK SAR, P.R. China; Sept 30, 2003 HKU39849 TOR2 HKU-66078 86 Urbani SIN2677 CUHK-Su10 66 HKU-65806 HKU-36871 99 BJ01 CUHK-W1 GZ50 GZ01 GZ60 60 94 GZ43 0.0005

18. HKU, HK SAR, P.R. China; Sept 30, 2003 A B C C D

19. Serological test for pair sera from patients with SARS HKU, HK SAR, P.R. China; Sept 30, 2003 • 1st sera • 2nd sera • Titer increase • Sample • number • Total • - • ++++ • > 4 folds • 21, 22, 23, 24, 26, 27, 28, 30, 31, 34, V • 11 • + • ++++ • > 4 folds • 4, 18, 32, III • 4 • +++ • ++++ • < 4 folds • 1, I, II, IV • 4 • Total • 19

20. HKU, HK SAR, P.R. China; Sept 30, 2003 Questions????? Where the SARS-Cov came from, Or how it was derived from? What we know, what we don’t know and, what studies are needed.

21. G3 IBV1 IBV2 TGEV G1 229E NIDOV PEDV CUHK HK36 SARS G4? GZ43 GZ50 CAN CDC-USA HK39 BOV1 BOV2 G2 MHV3 10 MHV1 MHV2 HKU, HK SAR, P.R. China; Sept 30, 2003

22. HKU, HK SAR, P.R. China; Sept 30, 2003 Observation • Several observations support the hypothesis of a wild animal reservoir • cases began independently in at least 5 different municipalities • early cases more likely to report living near agricultural market • 39% (9/23) of early cases were food handlers with likely animals contact

23. HKU, HK SAR, P.R. China; Sept 30, 2003 Himalayan palm civet (Paguma larvata) Hog-badger (Arctonyx collaris) Beaver (Castor fiber) Chinese Ferret-Badger (Melogale moschata) Raccoon-dog (Nyctereutes procyonoides) Chinese muntjac (Muntiacus reevesi) Chinese Hare (Lepus sinensis) Domestic cat (Felis catus) Eight species of wild and domestic animals were sampled in a live-animal market of Shenzhen on May 7, 03

24. Methods Human Animals Sampling (nasal, rectal swabs, blood) Blood RT-PCR diagnostic test Virus isolation and identification Neutralizing antibody detection Sequencing viral genome Western Blot Assay Sequence comparison Phylogenetic analysis HKU, HK SAR, P.R. China; Sept 30, 2003

25. Himalayan palm civet Raccoon-dog Six civets sampled, 4 out of them were PCR positive and 4 viruses were isolated One animal was PCR positive and 1 virus was isolated HKU, HK SAR, P.R. China; Sept 30, 2003

26. EM Photo of SCoV-like viruses HKU, HK SAR, P.R. China; Sept 30, 2003

27. M ORF1a N S ORF1b E 1 kb 5 kb 10 kb 15 kb 20 kb 25 kb 30 kb ORF 10 ORF 13 ORF 13 ORF 11 N N ORF 9 B 27900 bp 27700 bp 28000 bp 27800 bp 28100 bp 28200 bp Human Animal ORF 9 ORF 10´ CCTACTGGTTACCAACCTGAATGGAATAT Genome difference between animal and human SARS-Cov Deletion of human virus HKU, HK SAR, P.R. China; Sept 30, 2003

28. HKU, HK SAR, P.R. China; Sept 30, 2003

29. Phylogenetic analysis of S gene of human and animal SARS viruses SZ1 Animal SZ13 MHV SZ16 SZ3 GZ50 CUHK-W1 HKU36871 HKU39848 HKU66078 Human HKU65806 Urbani Tor2 GZ01 GZ60 GZ43 100 nucleotide HKU, HK SAR, P.R. China; Sept 30, 2003

30. Detection of antibodies against recombinant nucleocapsid protein of SCoV in animal sera by Western Blot Assay HKU, HK SAR, P.R. China; Sept 30, 2003

31. Antibody detection from people working at the market HKU, HK SAR, P.R. China; Sept 30, 2003

32. Summary 1. SCoV-like viruses are prevalent in different types of wild animals in the retail market. 2. These animals together mankind forming a new ecosystem. 3. SARS is zoonosis. HKU, HK SAR, P.R. China; Sept 30, 2003

33. Need for further animal research • To control SARS we must understand the natural history of the virus • Field and laboratory studies are needed to determine the possible range of animal reservoirs, if there are amplification hosts and how the virus spills over to humans • Control strategies must focus on human and animal populations to be effective HKU, HK SAR, P.R. China; Sept 30, 2003

34. HKU, HK SAR, P.R. China; Sept 30, 2003 Acknowledgements 1. NIAID, Grant A195357 2. Ministry of Health, China Government 3. Guangdong Government 4. Guangdong CDC 5. The First Affiliated Hospital, Guangzhou Medical College 6. Department of Health, Shenzhen Government 7. Shenzhen CDC 8. Department of Microbiology, HKU