1 / 17

Genetics and Biometrics

Genetics and Biometrics. Definitions. Locus The position of a coding or non coding genetic element Gene All the nucleotide elements required for the expression of a transcript Promoter , ORF, introns, exons, etc. Genetic Definitions ( Cont’d ). Allele

valentine-glover
Download Presentation

Genetics and Biometrics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genetics and Biometrics

  2. Definitions • Locus • The position of a coding or non codinggeneticelement • Gene • All the nucleotideelementsrequired for the expression of a transcript • Promoter, ORF, introns, exons, etc.

  3. GeneticDefinitions(Cont’d) • Allele • Version of a geneticelementat a given locus • Everyonenecessarily has twoalleles for eachgenomic locus • The twoallelesmaybe the same • Homozygotes • The twoallelesmaybedifferent • Heterozygote • A population of individualsmay have multiple alleles of a genomic locus

  4. GeneticDefinitions(Cont’d) • Genotype: • Nucleicacidsequence responsable for the phenotype • Physicaldetection by molecular techniques • Phenotype: • Trait thatcanbedistinguishedresultingfrom a genotype • Severaldifferentgenotypesmay have the samephenotype

  5. The Differences • Between individuals of the same sex • <0.5% • Between humans and chimpanzes • <2%

  6. Molecular Markers • Characteristics of the nucleotide sequence • The phenotype often corressponds to a specific genotype • Restriction polymorphisms (RFLP) • Length polymorphisms (VNTR) • Variable number of tandem repeats • Single nucleotide polymorphisms (SNP)

  7. Length Polymorphisms - RFLP • Based on the presence or absence of a restriction site at a givenpoistion • Ex. The enzyme EcoR1 recognizes and cleaves the sequence: • GAATTC • A single base mutation abolishes the site • GAGTTC

  8. Polymorphism E E E E E A B * A+B 1 2 Genome 1 Genome 2 Detection of Genomic RFLP 2 possible phenotypes • 2 alleles can be distinguished • Several possible genotypes 8

  9. Detection of RFLP by PCR

  10. Length Polymorphisms • Minisatellites and Microsatellites: • Sequencesrepeated in tandem • Highly variable number of repetitionsbetweenindividuals; thusseveralalleles • Lengthpolymorphisms • Molecularphenotype=Genotype • Minisatellites • Low distribution throughout the genomeMostlyfoundwithintelomeres • Microsatellites: • High distribution throughout the genome • VNTR

  11. VNTRs • The number of repetitions • = different lengths • = different alleles • = different genotypes • = different molecular phénotypes

  12. Exemples: DinucleotiderepeatGTGTGTGTGTGT…… TrinucléotiderepeatACGACGACGACG…… TetranucléotiderepeatTATCTATCTATC…… LengthPolymorphisms - VNTR • DNA Regionwhere tandem copies of di-, tri- or tetrarepeatedunits are located

  13. Allele1 CA CA CA CA CA Allele2 CA CA CA CA CA CA CA CA Allele3 CA CA CA CA CA CA CA CA CA CA CA CA VNTR (Cont’d) Different fragment lengths would be generated by a digestion at the indicated positions • Highly variable number of repetitionsindividuals • Thusseveralalleleswithin a population

  14. Individual 1 AGCTGCTTAATGCTGCTGCTGCTGCTGCTGCATAACATTGC Individual 2 AGCGGCTTAATGCTGCTGCATAACATTGC 1 2 Amplification & gel separation Detection of VNTR by PCR 14

  15. Biometrics

  16. VNTR Profile of NuclearGenome From whom does the blood come from? 16

  17. Bob Marc Luc Paul Tom VNTR Profile of NuclearGenome Who is Bob’s father? 17

More Related