1 / 40

Standardization of Pedigree Collection

This article discusses the genetic approaches, such as linkage and association studies, used to identify genes associated with Alzheimer’s Disease. It explores the role of environmental factors and discusses the challenges in identifying genes for complex diseases. The article also highlights the importance of collecting samples from affected and control subjects and the use of linkage and association tests.

vmartinez
Download Presentation

Standardization of Pedigree Collection

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Standardization of Pedigree Collection

  2. Genetics of Alzheimer’s Disease Environmental Factor 1 Environmental Factor 2 Gene 1 Gene2 Alzheimer’s Disease

  3. Genetic Approaches to Gene Identification In Alzheimer’s Disease

  4. Association Test candidate gene Collect sample of affected and control subjects Compare frequency of a genetic polymorphism in 2 samples Linkage Test entire genome Collect families with multiple affected members Identifying genes for complex disease Affected Control

  5. Linkage vs. Association • Linkage • Measures the segregation of alleles and a phenotype within a family • Detected over large physical distances • Association • Measures preferential segregation of a particular allele with a phenotype across families • Detected over shorter distances

  6. Meiosis and Linkage • Gamete formation • Meiosis I: Homologous chromosomes pair • Crossing over occurs • Genes that are physically close together are more likely to be coinherited • Genes that are physically far apart on the chromosome are less likely to be coinherited

  7. Linkage Approach • Seeks to identify, IN FAMILIES, chromosomal regions that are consistently transmitted to affected individuals. • Identify these regions using ‘markers’ • Find a marker which is ‘linked’ to the disease

  8. Linkage: Autosomal Dominant

  9. Traditional Linkage Approach • Successful in the identification of genes for Alzheimer’s disease • Amyloid precursor protein (APP) • Presenilin I (PS1) • Presenilin II (PS2)

  10. Further Genetic Studies • Clearly, most families with Alzheimer’s disease do not have a clear pattern of Mendelian inheritance • Already, one susceptibility gene has been identified whose alleles can either increase or decrease the risk of AD • There are certainly other genes which are to be identified

  11. How to tackle finding these other genes?

  12. Genetics of Alzheimer’s Disease Environmental Factor 1 Environmental Factor 2 Gene 1 Gene2 Alzheimer’s Disease

  13. Linkage in Complex Disease • Identify families with multiple affected members • Increases the likelihood that genes are important in disease susceptibility in that family • Pattern of inheritance less certain • Collect family members to follow segregation of disease and marker alleles

  14. Identity By Descent (IBD) • Allele 1 AGCTCACACACACACACACACAATCG • Allele 2 AGCTCACACACACACACAATCGTCGA • Allele 3 AGCTCACACACACAATCGTCGACCGC • Allele 4 AGCTCACACACAATCGTCGACCGCGG

  15. Linkage Analysis • Employ nonparametric linkage methods • Identify chromosomal regions that are preferentially transmitted within a family to the affected individuals. • Method is not based on recombination but on IBD marker allele sharing

  16. Analysis of Affected Relatives • Look for chromosomal regions shared in common by affected relatives in the same family. • Presume that affected individuals in the same family will have some similar susceptibility genes. • Look at patterns across families to determine if the same chromosomal region is being shared.

  17. Genome Screen Approach • Evaluate the entire genome • Analyze markers located at regular intervals throughout the genome • Identify regions that are consistently shared by affected relatives Markers

  18. Association Studies • Once a chromosomal region has been identified which is linked to AD, additional studies are necessary to identify the causative gene • Association studies typically test for linkage disequilibrium rather than linkage. • Linkage disequilibrium extends over shorter distances. • Often employ SNPs.

  19. Association Studies • Studies of linkage disequilibrium can study: • Transmission of alleles throughout a family consisting of affected and unaffected individuals. • Compare allele frequencies between affected and unaffected individuals. • Many new methods are being developed to more effectively test for linkage disequilibrium.

  20. AD Genetics Initiative Goals • Identification of genes contributing to Mendelian forms of AD are very important. • Provide insight into important pathways • Provide potential candidate genes to examine in non-Mendelian forms of disease • This study seeks to identify the genes contributing to non-Mendelian forms of AD.

  21. Design of the AD Genetics Initiative

  22. Appropriate Families for Study • At least 2 living siblings with LOAD (onset > 60 years) • At least 1 other living related family member who : • Has AD (onset > 50 years) Or • Is unaffected (> 60 years)

  23. Appropriate Families for Study • Who should be collected in this family? Why? • If parents in generation I are alive, they should be collected. • Collection of the parents will allow allele sharing to be determined more definitely in studies of the siblings in generation II. • More definitive allele sharing produces more definite linkage results -> more power to find genes for AD I II

  24. Appropriate Families for Study • Who should be collected in this family? Why? • Collect all siblings in generation II (AD and non-AD) • This is particularly important if the parents in generation I are deceased • Study allele sharing in generation II. • Studies can compare allele sharing among the AD siblings and the discordant siblings • Can evaluate linkage disequilibrium. I II

  25. Deceased Family Members • Testing markers in the parents and offspring of a deceased person makes it possible to estimate what the individual must have inherited

  26. Reconstruction • Estimating a missing person’s likely genotype is termed ‘reconstruction’. • This is the principal being employed in the identification of specimens in many forensic cases.

  27. Power to Reconstruct • The power to reconstruct a missing genotype is dependent on how many closely related family members can be sampled. • The important people to sample are the offspring of a deceased, affected individual.

  28. Appropriate Families for Study • Who should be collected in this family? Why? • Offspring of the individuals in generation II can be important for genetic studies. • Do any individuals in generation III have symptoms of memory loss or AD? If so, collect them. • Are any of the individuals in generation III over the age of 60 years? Longitudinal follow-up of these individuals may identify new cases of AD. I II

  29. Appropriate Families for Study • Who should be collected in this family? Why? • If any offspring in generation III are collected, it is important to also collect both their parents, when possible. • The individual in blue is important when determining which alleles the offspring in generation III have inherited from her affected father. I II III

  30. Appropriate Families for Study • Who should be collected in this family? Why? • Did anyone in the family have an autopsy and is tissue still available? • Collect information about these individuals and consider obtaining these materials, if possible. I II

  31. Who to collect? • A commonly asked question is who should I collect a blood sample from in a genetic study? • The answer is all genetically informative individuals!

  32. Who is genetically informative • Genetic analysis seeks to study the transmission of marker alleles throughout the family. • When we can determine the inheritance of all marker alleles unambiguously, we have the greatest power to find genes for disease! • Unaffected individuals may be very important for collection.

  33. Who is genetically informative • Collect affected individuals • Collect as many individuals with a • as are willing to participate

  34. Who is genetically informative • Collect affected individuals • Collect as many individuals with a • as are willing to participate Insert pedigree with affected siblings + aunt go through who to collect summarize at bottom of slide

  35. Which are the best families? • Families with the largest number of affected individuals. • Strong family history suggests more genetic. • Unaffected individuals in families with many affected individuals are also very important, particularly if they are examined clinically.

  36. Who is genetically informative • Collect all affected individuals • Collect any living connecting relatives • Collect any unaffected siblings

  37. Which are the best families? • Cooperative Families • Families eager to participate in research will typically complete the study faster. • Provide annual follow-up information more easily. • Assist in research if additional information/samples are needed. • Important to remain in contact with families and provide them with information about the study

  38. Who to Collect • Collect the parents in generation I, if available • Collect all siblings in generation II (affected and unaffected) • Collect any individuals in generation III with memory loss • Collect any individuals in generation III > 60 years • Query for any other affected cousins, half siblings, aunts, uncles?? I II III

  39. When in Doubt?? • Contact Susan LaRusse who will help sites identify the critical individuals in their pedigrees.

More Related