1 / 10

DNA Replication

DNA Replication. Replicated/Synthesized DNA. Necessary: Cell division into new cells (mitosis) meiosis (gamete formation). DNA Replication (Copying). ** Newly synthesized DNA is EXACTLY the same as the parent DNA…Remember S phase of Interphase !!.

waneta
Download Presentation

DNA Replication

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Replication

  2. Replicated/Synthesized DNA • Necessary: • Cell division into new cells (mitosis) • meiosis (gamete formation)

  3. DNA Replication (Copying) ** Newly synthesized DNA is EXACTLY the same as the parent DNA…Remember S phase of Interphase!!

  4. The *Enzyme DNA Helicase(Yellow Below) Unzips the DNA Into Two Strands **One strand is copied forward, the other backward! *We’ll look at enzymes more closely later on!!!

  5. The Enzyme DNA Polymerase Adds Base Compliments

  6. Base-Pairing Occurs With the DNA Strands ** Remember, A’s and T’s pair, C’s and G’s pair

  7. Short Video

  8. Real DNA/Enzyme Interaction

  9. Replicate the Following DNA Strand Into A New Strands ATGCGCTTAGGCGTCCGGTAAGTCGATCGAT T A C G C G A A T C C G C A G G C C A T T C A G C T A G C T A A’s and T’s pair, C’s and G’s pair

  10. Let’s Replicate on the Board!! Pretty Colors……

More Related