2nd Quiz, Name, date

1. 2nd Quiz, Name, date • 1 Pick one of the following two: • A)What are microsatellites (SSR) and what are they used for? • B)Is it true plants are always susceptible to exotic microbes? • 2 Pick one of the following two: • A) What are the infection pathways of Sudden Oak Death? • B)- What are the disease characteristics of Sudden Oak Death?

2. Summary of 2nd class • Host-Pathogen interactions. Quantitative vs. qualitative resistance • Plant recognition system recognizes multiple signals, including sometimes exotic pathogens • Upon recognition plant produces secondary metabolites that act as antibiotics

3. Summary of 2nd class Introduced diseases are characterized by simplified genetic structure Simplified means less allelic diversity and/or less divergence among alleles DNA allows to compare individuals based on differences of nucleotides DNA sequences need to be aligned before they can be compared

4. Summary of 2nd class • One locus may be useful or not, but we must be careful because a single marker can be deceptive (gene acquired from other species) • Multiple unlinked markers boost confidence and allow to identify individual. Following “individual” important to understand pathways • Need to compare sequence with dataset and unknown must cluster with known species. To be significant, each species must have its own statistically supported clade

5. Summary of 2nd class With multiple markers we can also see whether there is linkage disequilibrium or not, which is indicative of sex Sex important to predict adaptation to new environment, but also important because often exotic diseases have only one mating type (hence no sex) where they have been introduced

6. Summary of 2nd class • Emergent disease: changes in host, pathogen or environment • Cypress canker a disease in the Med because introduced (low genetic diversity,no sex, all individuals descending from a founder in Central Italy which in turn comes from Northern California) • In CA, more diversity, possibly sex, disaese because cypress planted away from coast, or because a new species was created for ornamental purposes

7. Why a disease in CA? • If pathogen is native to California, why is it causing such a serious disease? • We observed that disease incidence is variable with: • cypress species, • location,

8. Range of susceptibility • Leyland cypress, Italian, monterey are listed as most susceptible • Arizona and McKnob are regarded as more resistant

9. Range of susceptibility • 90% of Leyland are heavily infected • 10% of monterey • LEYLAND CYPRESS IS AN ORNAMENTAL CROSS, NOT NATIVE

10. Range of susceptibility • Monterey is more susceptible in inland areas where it is NOT NATIVE: we believe that colder temperatures cause more wounds that lead to infection

11. CONCLUSIONS • Cypress canker is a serious disease in Europe because pathogen was introduced • Cypress canker is a serious disease in California because hosts were introduced either through planting off range (Monterey cypress) or because host is artificial creation (Leyland cypress); extinction of LEYLAND is most likely

12. “Emergent diseases”:2: environmental changes • Forestry and intensive forest use: timber production tree felling and creation of stumps fire exclusion and increase in density oversimplified forest composition changes in forest composition changes in forest structure

13. Heterobasidion root disease • Heterobasidion (a bracket or shelf mushroom) infects trees through wounds and stumps, then it spreads through the roots to neighboring trees • With tree felling,stumps and wounds are created, suddenly exponentially increasing infection levels

14. Heterobasidion shelf fruit-body

17. Use of molecular genetics: • Differentiate Heterobasidion on fir/sequoias (H. occidentalis) from that on pine/junipers (H.irregularis) • Show that airborne meiospores are responsible for most infection of Heterobasidion • Show that in pines most infections start on stumps and that in true firs most infections on wounds

18. True firs Pines Each spore is a genetically different individual: In pines we found the same genetic individual in stumps and adjacent trees indicating direct contagion between the two In true firs and true firs/sequoias we find same individual in adjacent standing trees indicating infection not linked to stumps but to wounds on standing trees

19. CONCLUSIONS: • Logging activities increase Heterobasidion infection because of stump creation in pines and because of wounding in true firs sequoias • We have shown that in pine stumps H. irregularis and H. occidentalis can both be present and create a new hybrid entity • We have shown that in the past these hybridization events have lead to sharing of genes among these two species (Horizontal gene transfers)

20. Armillaria root diseases • Armillaria, the honey mushroom, normally infects the roots of trees. It can be a saprobe and a pathogen and is common amongst oaks • If woodland composition shifts to pine/oak, pines become the target of attacks and gaps in canopy enlarge over time. Stress (e.g. flooding) exacerbates susceptibility

21. Clusters of Armillaria

22. How Does it Infect? • Two means of dispersal to other trees: • Mycelium can grow through direct root contacts and grafts with uninfected trees. • Rhizomorphs can grow through soil to contact uninfected trees. OAK or PINE DEAD OAK SOURCE: http://www.forestpathology.org/dis_arm.html

23. What are Rhizomorphs? SOURCE: http://www.nifg.org.uk/armillaria.htm • …“conglomerations of differentiated parallel hyphae with a protective melanized black rind on the outside.” • Rhizomorphs are able to transport food and nutrients long distances which allows the fungus to grow through nutrient poor areas located between large food sources such as stumps. SOURCE: http://botit.botany.wisc.edu/toms_fungi/apr2002.html

24. Humongous Fungus It’s One of U-HAUL’s “Bizarre Roadside Attractions” http://botit.botany.wisc.edu/toms_fungi/apr2002.html

25. CONCLUSIONS Human activities shifting from oak woodlands to mixed oak-pine lead to large mortality gaps in pines around oaks if honey mushroom is present CHANGING SPECIES COMPOSITION LEADS TO SEVERE DISEASE

26. Many gaps with very little regeneration and have not closed in

27. Change in gap area 1972-1999

28. “Emergent diseases”:3: exotic pathogens • 99% of times human responsible for their introduction

29. Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

30. California invaded: 1849 A.D. Port Orford Cedar Root Disease 1950s New hybrid root pathogen 1990s Manzanita/madrone die-back Sudden Oak Death 1990s White pine blister rust 1930s Canker-stain of Sycamores 1980’s Dutch Elm Disease 1960s Pitch canker disease 1980s Oak root canker 2000

31. How can people transport pathogens • By transporting plants and plant parts • Crops, and seeds • Raw food • Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity

32. The Irish Potato Famine • From 1845 to 1850 • Phytophthora infestans • Resulted in the death of 750,000 • Emigration of over 2 million, mainly to the United States.

33. What favors invasion of exotic fungi ? • Density of host increases severity of disease • Corridors linking natural habitats • Synchronicity between host susceptibility and pathogen life cycle • Ecological and environmental conditions

35. Girdling aerial ‘cankers’ removed from roots

36. Big Sur 2006 K. Frangioso

37. P. ramorum absent P. ramorum present Wickland et al., unpublished

38. P. ramorum growing in a Petri dish

39. Organism new to science • Origin unknown • Biology unknown • Symptoms caused unknown • Immediately though highly regulated

40. Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada Stem canker Leaf necrosis

41. Sporangia Phytophthora ramorum Chlamydospores

42. Is it exotic? • Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism • Many hosts appear to have no resistance at all • Limited geographic distribution

43. Where does it come from? • It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction

44. Let’s look at its genetic structure • Need a number of independent and neutral DNA markers • Used AFLP, a technique that scans the entire nuclear genome • Are our isolates the same as the European ones? • Is the genetic structure suggestive of an introduced or native species?

45. US forest isolates clearly distinct from EU nursery isolates, also have different mating type • Isolates from nurseries in WA, OR, & BC both of the US and EU types • Potential for XXX sex and recombination in US nurseries • US forest population is genetically very homogeneous, trademark of an introduced species

46. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT

47. Mating Type A1 A2 A2 Growth Rate Fast Slow Fast

48. Terminology Genotype Lineage Population

49. Results of 1st microsatellite study • There actually three distinct (genotypically and phenotypically) lineages of P. ramorum • Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage • Several genotypes but only one lineage in EU nurseries • Three lineages in US nurseries

50. Was the pathogen first in US forests or in US nurseries? Slide 12