1 / 38

E. coli 0157:H7: A New Emerging Disease

E. coli 0157:H7: A New Emerging Disease. 1982: First recognized as pathogen 1983: Linked to hemolytic uremic syndrome 1990: Outbreak from drinking water 1991: Outbreak from apple cider 1993: Large outbreak from hamburgers. E. coli 0157:H7: Clinical Manifestations. Condition

wilbur
Download Presentation

E. coli 0157:H7: A New Emerging Disease

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. E. coli 0157:H7: A New Emerging Disease • 1982: First recognized as pathogen • 1983: Linked to hemolytic uremic syndrome • 1990: Outbreak from drinking water • 1991: Outbreak from apple cider • 1993: Large outbreak from hamburgers

  2. E. coli 0157:H7: Clinical Manifestations Condition Asymptomatic carriage Nonbloody diarrhea Hemorrhagic colitis Hemolytic-uremic syndrome Complications of enteric infection Frequency Unknown 10% 90% 10% <10 years <5% Clin Infect Dis 1995;20:1

  3. Barium-enema showing “thumbprinting” in colon of child with E. coli O157:H7 hemorrhagic colitis, due to edema and submucosal hemorrhage N Engl J Med 1995;333:364

  4. Colonic biopsy from patient with E. coli O157:H7 infection Biopsy showing ischemic injury with superficial coagulative necrosis, mucosal hemorrhage, and an overlying inflammatory pseudomembrane N Engl J Med 1995;333:364

  5. Hemolytic Uremic Syndrome • Days to 2 weeks after gastroenteritis • Pallor, bruising, lethargy • Anemia (Hgb=5-7 mg/dl), thrombocytopenia • Hematuria, acute renal failure • Death: 3%-5% • E. coli O157:H7 isolated from 96% of patients when culture performed within 6 days of onset

  6. Pathogenesis of E. coli O157:H7 infection

  7. Incidence of E. coli O157:H7 infection,United States Source: CDC

  8. Outbreaks of E. coli 0157:H7reported to CDC, 1982-1994 Vehicle Ground beef All beef + milk Water (drinking/swimming) Person-to-person Unknown All outbreaks No. outbreaks 22 26 3 9 19 69 No. persons 1,137 1,278 276 243 274 2,334 Epidemiol Rev 1996;18:29

  9. Outbreaks of E. coli 0157:H7reported to CDC, 1982-1994 Epidemiol Rev 1996;18:29

  10. E. coli 0157:H7: Vehicles of infection • Undercooked hamburgers • Bovine manure • Contaminated water (e.g., lakes, water slides) • Alfalfa sprouts • Mayonaise • Unpasteurized apple cider • Unpasteurized milk

  11. E. coli 0157:H7 in food • Present in any food w/bovine fecal contamination • Infectious dose: probably <5 organisms • Present in 1%-2% of ground beef, pork, poultry, lamb retail meat samples in Madison, WI • Present in about 10% of raw milk samples Epidemiol Rev 1996;18:29

  12. Geographic distribution of E. coli O157:H7: Total Number of Reported Cases, 1996

  13. Pathogen Salmonella Campylobacter E. coli O157:H7 Clostridium perfringens Listeria monocytogenes Staphylococcus aureus Cases 696,000-3,840,000 1,100,000-7,000,000 8,000-16,000 10,000 928-1,767 1,513,000 Cases of foodborne illness,selected pathogens, 1995 Deaths 870-1,920 110-511 176-433 100 230-485 454

  14. Onset of E. coli O157:H7 infections and HUS, Dec. 1, 1992-Feb. 28, 1993, Washington State Black bars indicate primary cases; shaded bars, secondary cases; and white bars, unclassified cases • 631 cases reported (501 cult. confirmed) • Median age 8 • 45 cases of HUS, 3 died • Median incubation 4 days • Undercooked burgers at “chain A”, 58/64 restaurants had at least 1 case • Burgers cooked 1 minute/side: routinely associated with internal temp. <68.3 C • Molecular epidemiology: single clone Click for larger picture JAMA 1994;272:1349

  15. E. coli 0157:H7 at the Washington County Fair, New York, 1999 • 921 persons reported diarrhea • E. coli 0157:H7 isolated from 116 persons; 13 coinfected with Campylobacter jejuni • 32 infected with C. jejuni alone • 65 persons hospitalized, 11 children w/HUS • 2 deaths: 3 yo w/HUS and 79 yo w/HUS/TTP • Source: consumption of water from shallow unchlorinated well MMWR 1999;48:803

  16. Outbreak of E. coli O157:H7 Among Children Associated With Farm Visits – Montgomery County, PA, 2000 • September-November 2000: Montgomery County HD identified 51 persons with diarrhea <10 days of visiting a dairyfarm (farm A) • Age range 1-52 years (median: 4 years) • Bloody diarrhea (37%), fever (45%), vomiting (45%) • 16 patients were hospitalized and eight developed HUS MMWR 2001;50:293

  17. Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Molecular Epidemiology • Isolates from patients indistinguishable by PFGE • All 216 cattle on Farm A cultured by rectal swab • 28 (13%) positive for outbreak strain • Same strain isolated from railing surface MMWR 2001;50:293

  18. CDC Investigator Examines aCalf at “Farm A”, Pennsylvania, 2000 MMWR 2001;50:293

  19. Outbreaks of E. coli O157:H7 Among Children Associated With Farm Visits: Case-Control Study of Risk Factors Exposure Contact with cattle Nailbiting Food from concession Handwashing before eating Odd ratio (95% CI) 10.9 (1.7-70.7) 2.5 (1.1-5.7) 2.5 (1.1-5.7) 0.2 (0.1-0.7) MMWR 2001;50:293

  20. Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995 N Engl J Med 1997;337:388

  21. Patterns on Pulsed-Field Gel Electrophoresis of E. coli O157:H7 in Minnesota Lanes 1, 6, 10: E. coli 0157:H7 standard Lane 5: add. mole. wt. standard Lanes 2, 4, 7, 8: sporadic cases Lanes 3, 9: isolates from single cluster N Engl J Med 1997;337:388

  22. Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1995 Click for larger picture N Engl J Med 1997;337:388

  23. Routine DNA Fingerprinting by Health Departments: E. coli O157:H7, Minnesota, 1994 Click for larger picture N Engl J Med 1997;337:388

  24. Confirmed E. coli O157:H7 outbreaksin Minnesota, 1994 and 1995 Click for larger picture N Engl J Med 1997;337:388

  25. Molecular subtyping of E. coli 0157:H7 has revolutionized population-based surveillance for this organism in Minnesota. We now routinely subtype all E. coli 0157:H7 isolates and consider this technique to be an integral part of disease prevention and control in our state. Minnesota Department of HealthN Engl J Med 1997;377:388

  26. The Colorado Department of Public Health recently identified an outbreak of E. coli 0157:H7 infection associated with . . .six lots of Hudson foods frozen ground beef patties and burgers. On August 7, 1997, CDPHE’s public health laboratory reported that 15 of 27 E. coli isolates submitted for routine molecular subtypingsince June 1 were characterized by highly related PFGE patterns. . . CDCMMWR 1997;46:777.

  27. PFGE patterns of Salmonella entericaserotype Typhimurium, by Week, Minnesota, June - September 1995 Click for larger picture N Engl J Med 2001; 344:189

  28. Coordinated by CDC • National network of PH labs that performs PFGE on foodborne bacteria • Salmonella serotype Typhimurium • Escherichia coli 0157:H7 • Others planned • Permits rapid comparison of PFGE patterns through electronic database at CDC • Pennsylvania Department of Health participates www.cdc.gov/ncidod/dbmd/pulsenet/pulsenet.htm

  29. Prevention • Surveillance for E. coli 0157:H7 and HUS • Modernization of food inspection • Education of physicians • Education of public

  30. Limitations of Pulsed-Field Gel Electrophoresis • Substantial intra-/inter-laboratory variation • Interpretation of banding patterns subjective • Requires additional enzymes to prove “matches” • Analyzing across gels difficult • PFGE stored as large image files • Requires isolation of the organism • Slow • Ongoing, automated computer analysis difficult

  31. Chain Termination DNASequencing (Sanger Method) A: New DNA synthesized as polymerase moves down template DNA, away from primer B: Nucleotides added until dideoxynucleotide incorporated. C: Labeled primer D: Labeled deoxynucleotides Click for larger picture E: Labeled dideoxynucleotides

  32. Multilocus Sequence Typing (MLST) • Sequencing of multiple housekeeping genes • State of the art (human genome project) • Objective: no need to compare banding patterns • Standardization of methods • Fully reproducible • Storage, transmission, analysis of ASCII files • More appropriate for ongoing, automated computer analysis • Do not need to isolate organism in culture • Fast

  33. Sequence v. PFGE Data TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC

  34. Serratia marcescens outbreak in a NICU Strain A isolates • Mar-Jul 1995, 23 cases • Mostly sepsis, 30% died • 2 simultaneous outbreaks • Most strain “A”, 4 “E” • Contamination between NICU (*) and 2 other wards (** and ***) * * ** * * * *** ** * J Clin Microbiol 1996;34:3138

  35. Cluster of Serogroup C Meningococcal Disease Associated With a Party • Case 1. 18-year-old male with headache, fever, nausea, vomiting on May 19, 1999. On May 20, presented with cardiopulmonary arrest and died. Blood cultures grew N. meningitidis. • Case 2. 20-year-old male presented with headache, back pain, and lethargy on May 21. Blood cultures positive for N. meningitidis. • Case 3. 21-year-old male, with headache, neck pain, vomiting, hypotension on May 25, 1999. Blood cultures positive for N. meningitidis • Common exposure: Attendance at a (wild!) party on May 14 S Med J, in press

  36. Cluster of Serogroup C Meningococcal Disease Associated With a Party: PFGE Analaysis (SpeI) Lanes 1, 6, 10: lambda ladder reference, lanes 2, 3, 4: N. meningitidis isolates from Cases 1, 2, and 3 respectively; lanes 5, 7, 8, 9: Group C N. meningitidis control isolates from 1999 1 2 3 4 5 6 7 8 9 10 S Med J, in press

  37. Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks: Summary • Routine molecular subtyping of key pathogens of public health importance leads to enhanced detection of foodborne outbreaks • Routine molecular subtyping should be an integral part of public health surveillance • DNA sequence-based methods may eventually replace restriction enzyme-based methods

More Related