620 likes | 897 Views
Molecular Pathogenesis of Hepatocellular Carcinoma: Emphasis on HBV. Pei-Jer Chen National Taiwan University and Hospital. HCC: Prevalence in the World. Gastroenterology. 132(7): 2557-76 (2007). Gastroentrology 2003;124:105-117. Liver cirrhosis and HCC.
E N D
Molecular Pathogenesis of Hepatocellular Carcinoma: Emphasis on HBV • Pei-Jer Chen • National Taiwan University and Hospital
HCC: Prevalence in the World Gastroenterology. 132(7): 2557-76 (2007)
Sequence of events leading to malignant transformation of hepatocypes Beta-catenin P53 Genomic instability ? cirrhosis Cycles of selecting Viral variants modified by Buendia MA, 2002
Liver Cancer and Hepatitis Viruses • HCC ranks 5th of human cancers in the world. • Two-thirds of HCC cases in Asia, due to a prevalent chronic HBV infection. • Universal vaccination programs against hepatitis viruses is the best way, as shown by HBV.
Immunization cohort Non-immunization cohort HBsAg carrier rate Age (yr)
Liver Cancer and Hepatitis Viruses • Universal vaccination programs began 20 years ago, it eliminates a lot of carriers from children. However, for adults cohort (not receiving vaccination) there are still about 300 millions HBV carries at risk to develop liver cancer.
Sequence of events leading to malignant transformation of hepatocypes cirrhosis Cycles of Selecting Viral variants Cycles of selecting Viral variants modified by Buendia MA, 2002
HBV Variants: Evolution from Chronic Infections Immune escape Variants ? 1896A variant: Pre-core 1762T/1764A variant: Basal Core Promoter Modified from Hunt CM, Hepatology 2000
Evolution of HBV in the children: Decreasing proportion of wild-type
Prevalence of HBV pre-core 1896 and BCP 1762/1764 mutants by age
Significance of New variants Evolving from the Patients • May differ from wild-type at initial infections. • Different immunogenicity ? • Different infectivity ? • Different carcinogenecity potential.
HBV and Host • Among HBV infected patients, about two-thirds remain healthy carriers (without hepatitis activities) for their life-time. • The other one-third succumb to liver cirrhosis or HCC. • Cases-Control--- Genetic association study
Viral Gene Proteins (Wild type or Variants) + Host Gene Products (Wild type or Mutant) Self-perpetuating pathways promoting cell regenerations, survival and invasiveness
Relatives of HBsAg-positive HCC with familial History Compared with those without familial History (MH Yu, et. al.)
Searching for Hereditary Components of HBV-related HCCs: Adopting the Amsterdam Criteria • Amsterdam criteria • The Amsterdam criteria identify families likely to have Hereditary nonpolyposis colorectal cancer (HNPCC). • At least 3 relatives with an HNPCC-associated cancer: colorectal cancer, or cancer of the endometrium, small intestine, ureter or renal pelvis. • One patient should be a first degree relative of the other two • At least two successive generations should be affected • At least one tumour should be diagnosed <50 years of age • Only 2-3% of HCC cases meeting the criteria.
The Affymetrix Human SNP Array 6.0 features more than 1.8 million markers for genetic variations. • 906,600 SNPs. • 946,000 probes for CNVs. Programs for genome-wide CNV detection. • Affymetrix Genotyping Console • HelixTree Copy Number Analysis Module (CNAM) • Partek's Genomics Suite
Strong predictors of diabetes were a family history of the disease, an increased body-mass index, elevated liver-enzyme levels, current smoking status, and reduced measures of insulin secretion and action. Variants in 11 genes (TCF7L2, PPARG, FTO, KCNJ11, NOTCH2, WFS1, CDKAL1, IGF2BP2, SLC30A8, JAZF1, and HHEX) were significantly associated with the risk of type 2 diabetes independently of clinical risk factors. • The addition of specific genetic information to clinical factors slightly improved the prediction of future diabetes, with a slight increase in the area under the receiver-operating-characteristic curve from 0.74 to 0.75; however, the magnitude of the increase was significant (P=1.0x10–4). The discriminative power of genetic risk factors improved with an increasing duration of follow-up, whereas that of clinical risk factors decreased. • Conclusions As compared with clinical risk factors alone, common genetic variants associated with the risk of diabetes had a small effect on the ability to predict the future development of type 2 diabetes. The value of genetic factors increased with an increasing duration of follow-up. NEJM November 20
Outcomes of Infection Diseases and Gender: Science V.298,2002
Gender Disparity: Causes • Susceptibility of males to HBV-related carcinogenesis • Protection of females against HBV-related carcinogenesis • Roles of sex hormones are implicated.
Higher risk of HCC among male carriers with higher testosterone Or androgen receptor genes with higher activities.
36 wks Reduced HCC incidence in mice lacking hepatic AR with little change of serum testosterone A B Ma et al., GASTROENTEROLOGY, 2008
Gender effect of viral etiology of HCC in Taiwan Gender Ratio (Male:Female) Age (mean) HBsAg/anti-HCV + / -7.7 52.2 - / +1.5 63.5 (n=1474 Dr. SN Lu)
HBV genome organization Modified from Hunt et al
AR ARE Hypothesis: HBx Activation of AR Axis and Potency Androgen / R1881 HBx Cytoplasm AR Nucleus
Fig.1 A
AR ARE Fig.7 Androgen / R1881 (not estradiol, or glucocorticoid etc.) HBx Calcium signaling Src kinase Cyclosporine A Cytoplasm PP2 PI3K (p85) AR Nucleus
HBV genome organization Modified from Hunt et al
Gender difference of HBV factors in our HBV transgenic mice 100 109 250 P < 0.001 P = 0.028 p = 0.038 108 200 80 107 150 HBsAg level (S/N) HBV Titer 106 100 60 Relative HBV Transcripts Amounts N = 20 N = 20 15 105 50 N = 20 N = 20 10 M F M F 104 0 5 P = 0.008 3000 N = 4 N = 19 2500 0 N = 19 M F 2000 1500 Relative Luciferase Activity 1000 N = 6 500 0 M F
150 P < 0.001 P = 0.003 Normal 100 (N=6) Relative HBsAg (%) 50 Castrated (N=6) 0 0 20 40 (day) 250 P = 0.007 P = 0.006 200 150 Relative HBV Titer (%) Normal 100 (N=6) 50 Castrated (N=6) 0 0 20 40 (day) Androgen involved in regulating HBV titer and HBsAg level Castration Male HBV tg mice 0 day 20 days 40 days Bleeding Bleeding Bleeding
PCR primer set Enh I region GAPDH IgG αPol II αAR Input αAR Input / IP ddH2O C Neg AR AR GFP GFP Lenti - - - + + - + + + R1881 200 bp - 100 bp - IgG IgG IgG αAR Input αAR αAR Input Input 200 bp - 100 bp - Other region Enh I region PCR primer set Enh II region GFP AR Lenti - - R1881 + AR - GFP - b-actin - AR(+R1881) may directly bind to HBV Enhancer I HepG2(2.2.15)
I-3 WT -R1881 I-3 WT + R1881 80 I-3 Mut -R1881 I-3 Mut + R1881 60 40 Relative Activation Fold 82 % 20 0 - + AR One ARE site in HBV Enh I-3 region is determined 750 1150 Luc gene I-3 WT TAGAAAACTTCCTGTTAACAG Mut TAGAAATGTTCCTCATAACAG Candidate ARE site
ARE Enh I Enh II HBV Virus factor HBV mRNA Host factor
Protective Effect of Estrogen against HCC in Females: HEPATOLOGY Vol.38, No. 6, December 2003
A B (Fig. 1)
An inverse correlation of miR-18a and ERa levels in female HCCs ESR1 as a cellular target of miR-18a. ERa is a potential cellular target of miR-18a