1 / 60

Molecular Pathogenesis of Hepatocellular Carcinoma: Emphasis on HBV

Molecular Pathogenesis of Hepatocellular Carcinoma: Emphasis on HBV. Pei-Jer Chen National Taiwan University and Hospital. HCC: Prevalence in the World. Gastroenterology. 132(7): 2557-76 (2007). Gastroentrology 2003;124:105-117. Liver cirrhosis and HCC.

wiley
Download Presentation

Molecular Pathogenesis of Hepatocellular Carcinoma: Emphasis on HBV

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Pathogenesis of Hepatocellular Carcinoma: Emphasis on HBV • Pei-Jer Chen • National Taiwan University and Hospital

  2. HCC: Prevalence in the World Gastroenterology. 132(7): 2557-76 (2007)

  3. Gastroentrology 2003;124:105-117

  4. Liver cirrhosis and HCC

  5. Sequence of events leading to malignant transformation of hepatocypes Beta-catenin P53 Genomic instability ? cirrhosis Cycles of selecting Viral variants modified by Buendia MA, 2002

  6. Semin Liver Dis. 2007 Feb;27(1):55-76

  7. Liver Cancer and Hepatitis Viruses • HCC ranks 5th of human cancers in the world. • Two-thirds of HCC cases in Asia, due to a prevalent chronic HBV infection. • Universal vaccination programs against hepatitis viruses is the best way, as shown by HBV.

  8. Immunization cohort Non-immunization cohort HBsAg carrier rate Age (yr)

  9. Liver Cancer and Hepatitis Viruses • Universal vaccination programs began 20 years ago, it eliminates a lot of carriers from children. However, for adults cohort (not receiving vaccination) there are still about 300 millions HBV carries at risk to develop liver cancer.

  10. Sequence of events leading to malignant transformation of hepatocypes cirrhosis Cycles of Selecting Viral variants Cycles of selecting Viral variants modified by Buendia MA, 2002

  11. HBV Variants: Evolution from Chronic Infections Immune escape Variants ? 1896A variant: Pre-core 1762T/1764A variant: Basal Core Promoter Modified from Hunt CM, Hepatology 2000

  12. Evolution of HBV in the children: Decreasing proportion of wild-type

  13. Prevalence of HBV pre-core 1896 and BCP 1762/1764 mutants by age

  14. HBV variants and HCC risk

  15. Significance of New variants Evolving from the Patients • May differ from wild-type at initial infections. • Different immunogenicity ? • Different infectivity ? • Different carcinogenecity potential.

  16. HBV and Host • Among HBV infected patients, about two-thirds remain healthy carriers (without hepatitis activities) for their life-time. • The other one-third succumb to liver cirrhosis or HCC. • Cases-Control--- Genetic association study

  17. Viral Gene Proteins (Wild type or Variants) + Host Gene Products (Wild type or Mutant) Self-perpetuating pathways promoting cell regenerations, survival and invasiveness

  18. Familial Cancer:

  19. Statistical Power of Multiplex Familial Cancers

  20. Relatives of HBsAg-positive HCC with familial History Compared with those without familial History (MH Yu, et. al.)

  21. Searching for Hereditary Components of HBV-related HCCs: Adopting the Amsterdam Criteria • Amsterdam criteria • The Amsterdam criteria identify families likely to have Hereditary nonpolyposis colorectal cancer (HNPCC). • At least 3 relatives with an HNPCC-associated cancer: colorectal cancer, or cancer of the endometrium, small intestine, ureter or renal pelvis. • One patient should be a first degree relative of the other two • At least two successive generations should be affected • At least one tumour should be diagnosed <50 years of age • Only 2-3% of HCC cases meeting the criteria.

  22. TLCN: Taiwan Liver Cancer Networking

  23. Phenotype distribution

  24. The Affymetrix Human SNP Array 6.0 features more than 1.8 million markers for genetic variations. • 906,600 SNPs. • 946,000 probes for CNVs. Programs for genome-wide CNV detection. • Affymetrix Genotyping Console • HelixTree Copy Number Analysis Module (CNAM) • Partek's Genomics Suite

  25. Strong predictors of diabetes were a family history of the disease, an increased body-mass index, elevated liver-enzyme levels, current smoking status, and reduced measures of insulin secretion and action. Variants in 11 genes (TCF7L2, PPARG, FTO, KCNJ11, NOTCH2, WFS1, CDKAL1, IGF2BP2, SLC30A8, JAZF1, and HHEX) were significantly associated with the risk of type 2 diabetes independently of clinical risk factors. • The addition of specific genetic information to clinical factors slightly improved the prediction of future diabetes, with a slight increase in the area under the receiver-operating-characteristic curve from 0.74 to 0.75; however, the magnitude of the increase was significant (P=1.0x10–4). The discriminative power of genetic risk factors improved with an increasing duration of follow-up, whereas that of clinical risk factors decreased. • Conclusions As compared with clinical risk factors alone, common genetic variants associated with the risk of diabetes had a small effect on the ability to predict the future development of type 2 diabetes. The value of genetic factors increased with an increasing duration of follow-up. NEJM November 20

  26. Outcomes of Infection Diseases and Gender: Science V.298,2002

  27. Gender Disparity: Causes • Susceptibility of males to HBV-related carcinogenesis • Protection of females against HBV-related carcinogenesis • Roles of sex hormones are implicated.

  28. Higher risk of HCC among male carriers with higher testosterone Or androgen receptor genes with higher activities.

  29. 36 wks Reduced HCC incidence in mice lacking hepatic AR with little change of serum testosterone A B Ma et al., GASTROENTEROLOGY, 2008

  30. Gender effect of viral etiology of HCC in Taiwan Gender Ratio (Male:Female) Age (mean) HBsAg/anti-HCV + / -7.7 52.2 - / +1.5 63.5 (n=1474 Dr. SN Lu)

  31. HBV genome organization Modified from Hunt et al

  32. Cancer Research V.63 P.7553-7562

  33. AR ARE Hypothesis: HBx Activation of AR Axis and Potency Androgen / R1881 HBx Cytoplasm AR Nucleus

  34. Fig.1 A

  35. AR ARE Fig.7 Androgen / R1881 (not estradiol, or glucocorticoid etc.) HBx Calcium signaling Src kinase Cyclosporine A Cytoplasm PP2 PI3K (p85) AR Nucleus

  36. HBV genome organization Modified from Hunt et al

  37. Gender difference of HBV factors in our HBV transgenic mice 100 109 250 P < 0.001 P = 0.028 p = 0.038 108 200 80 107 150 HBsAg level (S/N) HBV Titer 106 100 60 Relative HBV Transcripts Amounts N = 20 N = 20 15 105 50 N = 20 N = 20 10 M F M F 104 0 5 P = 0.008 3000 N = 4 N = 19 2500 0 N = 19 M F 2000 1500 Relative Luciferase Activity 1000 N = 6 500 0 M F

  38. 150 P < 0.001 P = 0.003 Normal 100 (N=6) Relative HBsAg (%) 50 Castrated (N=6) 0 0 20 40 (day) 250 P = 0.007 P = 0.006 200 150 Relative HBV Titer (%) Normal 100 (N=6) 50 Castrated (N=6) 0 0 20 40 (day) Androgen involved in regulating HBV titer and HBsAg level Castration Male HBV tg mice 0 day 20 days 40 days Bleeding Bleeding Bleeding

  39. PCR primer set Enh I region GAPDH IgG αPol II αAR Input αAR Input / IP ddH2O C Neg AR AR GFP GFP Lenti - - - + + - + + + R1881 200 bp - 100 bp - IgG IgG IgG αAR Input αAR αAR Input Input 200 bp - 100 bp - Other region Enh I region PCR primer set Enh II region GFP AR Lenti - - R1881 + AR - GFP - b-actin - AR(+R1881) may directly bind to HBV Enhancer I HepG2(2.2.15)

  40. I-3 WT －R1881 I-3 WT ＋ R1881 80 I-3 Mut －R1881 I-3 Mut ＋ R1881 60 40 Relative Activation Fold 82 % 20 0 - + AR One ARE site in HBV Enh I-3 region is determined 750 1150 Luc gene I-3 WT TAGAAAACTTCCTGTTAACAG Mut TAGAAATGTTCCTCATAACAG Candidate ARE site

  41. ARE Enh I Enh II HBV Virus factor HBV mRNA Host factor

  42. Protective Effect of Estrogen against HCC in Females: HEPATOLOGY Vol.38, No. 6, December 2003

  43. HEPATOLOGY Vol.38, No. 6, December 2003

  44. A B (Fig. 1)

  45. An inverse correlation of miR-18a and ERa levels in female HCCs ESR1 as a cellular target of miR-18a.  ERa is a potential cellular target of miR-18a

More Related