1 / 1

nprB

G. T A. A G. +. +. +. +. +. +. +. +. +. +. +. +. +. +. +. +. +. -. +. -. + a. +. +. +. +. +. +. +. T-A C-G C-C A-T T-A T-A G-C G-C A-T A-T G-C A-T A-T A-T A-T A-T T-A A-T T-A. yvfT. yvfU. nprB. plcR. papR. BC5354. BC5355. Group III.

wilma
Download Presentation

nprB

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. G T A A G + + + + + + + + + + + + + + + + + - + - +a + + + + + + + T-A C-G C-C A-T T-A T-A G-C G-C A-T A-T G-C A-T A-T A-T A-T A-T T-A A-T T-A yvfT yvfU nprB plcR papR BC5354 BC5355 Group III Group IV Group VI Group VII (A) BC5353 BC5352 BC5351 BC5350 BC5349 yvfT yvfU nprB plcR papR BC5354 BC5355 Chromosomal position 5 266 520 (1) (3) (5) 5 260 083 (4) (2) KmR CGCTTGATGCGAAAAATAGAATTGAGGCAATTACAATTGCGGAAGAAAAGGGTTGGATATAA -35 -10 +1 RBS GTTATTTCCTTATATTTGTTGTAGTATCAATATATATAAGAAAAAGACAGGAAGCGGTATAAATG (B)

More Related