1 / 15

Mutations Changes to DNA

Explore the types of mutations that can occur in DNA and how they affect protein synthesis, with a focus on point and frameshift mutations. Understand diseases like sickle cell anemia and cystic fibrosis resulting from genetic mutations.

wmercier
Download Presentation

Mutations Changes to DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mutations Changes to DNA

  2. Learner Outcomes • I can explain how mutations may or may not impact the protein that is made in protein synthesis. • I can identify and explain the different types of mutations.

  3. Standards Addressed: • Use mRNA codon charts to determine the effects of different types of mutations on amino acid sequence and protein structure (e.g., sickle cell anemia resulting from base substitution mutation) SC-HS-3.4.1 SC-H-UD-S-3 • SC-HS-3.4.1 (DOK 3) Students will explain the role of DNA in protein synthesis. Cells store and use information to guide their functions. The genetic information stored in DNA directs the synthesis of the thousands of proteins that each cell requires. Errors that may occur during this process may result in mutations that may be harmful to the organism.

  4. TACGCACATTTACGTACG DNA aa aa aa aa aa aa aa AUGCGUGUAAAUGCAUGC mRNA protein trait Mutations • Changes to DNA are called mutations • change the DNA • changes the mRNA • may change protein • may change trait

  5. Types of mutations • Changes to the letters (A,C,T,G bases) in the DNA • point mutation • change to ONE letter (base) in the DNA • may cause change to protein, may not • frameshift mutation • addition of a new letter (base) in the DNA sequence • deletion of a letter (base) in the DNA • both of these shift the DNA so it changes how the codons are read • big changes to protein!

  6. Point Mutations • One base change • can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

  7. Point Mutations • Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Doesthis changethe protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

  8. Sickle cell anemia • Hemoglobin protein in red blood cells • strikes 1 out of 400 African Americans • limits activity, painful & may die young Normalround cells Misshapensickle cells Only 1 out of146 amino acids

  9. Point Mutations • Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? Why not? The code hasrepeats in it! AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

  10. Point Mutations • Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyedthat protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop

  11. Frameshift Mutations • Add or delete one or more bases • changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

  12. Frameshift Mutations • Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

  13. Frameshift Mutations • Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

  14. Cystic fibrosis • Broken salt channel in cells • strikes 1 in 2500 white births • gene codes for a protein channelthat allows salt to flow across cell membrane • broken protein doesn’t work as channel • doesn’t allow salt out of cell, so water doesn’t flow out either • thicker & stickier mucus coating around cells • mucus build-ups in lungs & causes bacterial infections • destroys lung function • without treatment children die before 5; with treatment can live past their late 20s

  15. Deletion leads to Cystic fibrosis deletion Loss of one amino acid!

More Related