1 / 50

"PCR-based Species Identification and Gene Tagging"

"PCR-based Species Identification and Gene Tagging". Clint Magill, Ramasamy Perumal, C-L Yao Department of Plant Pathology & Microbiology TAMU. The Species to ID. Downy Mildews Primary Host Peronosclerospora sorghi Sorghum P. maydis Maize P. sacchari Sugarcane

wyome
Download Presentation

"PCR-based Species Identification and Gene Tagging"

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. "PCR-based Species Identification and Gene Tagging" Clint Magill, Ramasamy Perumal, C-L Yao Department of Plant Pathology & Microbiology TAMU

  2. The Species to ID • Downy Mildews Primary Host • Peronosclerospora sorghi Sorghum • P. maydis Maize • P. sacchari Sugarcane • P. philippinensis* all the above • Sclerospora graminicola pearl millet • Peronospora sparsa rose

  3. Common Characteristics of these Pathogens • Oomycetes-not true fungi • Asexual conidia if dew • Oospores from sexual reproduction in crop residue • Obligate parasites • Can’t grow in pure culture • Can’t cross on demand • Species differ in host preference and size of asexual “conidia” • Unknown genome size • No “marker” mutants or gene maps

  4. P. sorghi • conidia-asexual spores • antheridum and oogonium forming in leaf tissue

  5. Chenglin Yao, PhD • China quarantine service • Protect against P. philippinensis • Classify via average spore size in grain samples? • We have P. sorghi

  6. Can we use pathogen DNA to detect the pathogen ?

  7. Detection of infected progeny from a systemically infected maize plant via dot-blot hybridization using genomic P. sorghi gDNA

  8. Can we use DNA to differentiate closely related species?

  9. Peronosclerosporsa DNA PvuI digests sacchari/cane leaf sorghi/maize leaf sacchari-Y-maize leaf sacchari-G-maize leaf sorghi-Thailand sorghi-Thailand philip/cane leaf sorghi pt1/leaf sorghi-3 leaf srghi pt-1 srghi pt-3 maydis Probe: P. maydis gDNA

  10. Probe Development- P. sorghi Repeated Sequence Clones, Hybridized to P. sorghi gDNA

  11. Probe Development- P. sorghi Repeated Sequence Clones, Hybridized to P. maydis gDNA

  12. Peronosclerosporsa DNA PvuI digests sacchari/cane leaf philip/cane leaf sorghi/maize leaf sacchari-Y-maize leaf sacchari-G-maize leaf sorghi-Thailand sorghi-Thailand sorghi pt1/leaf sorghi-3 leaf srghi pt-3 srghi pt-1 maydis Probe: pMLY987

  13. Peronosclerosporsa DNA PvuI digests sacchari/cane leaf philip/cane leaf sorghi/maize leaf sacchari-Y-maize leaf sacchari-G-maize leaf sorghi-Thailand sorghi-Thailand sorghi pt1/leaf sorghi-3 leaf srghi pt-3 srghi pt-1 maydis Probe: pCLY83

  14. Dot-blot sensitivity test-probe pMLY12 ng of DNA P. sorghi pathotype 1 P. sorghi pathotype 3 pt1-Infected sorghum leaf pt3-Infected sorghum leaf “Botswana”-Infected maize leaf

  15. Dot-Blot Hybridizations; proble pMLY12 Colletotrichm graminicola P. sorghi Infected seed, with glume Acremonium strictum Healthy seed, with glume Fusarium moniliforme Infected seed, no glume Infected seed, glumes 40d Healthy seed, no glume Infected seed, no glumes 40d

  16. How about converting clones to sequences for PCR?

  17. P. sacchari/maize leaf P. sacchari/maize leaf P. sacchari/cane leaf P. phillip.//cane leaf P sorghi/Thailand-2 P sorghi/Thailand-1 infected leaf pt1 infected leaf pt3 maize leaf _Bots P sorghi pt3 P sorghi pt1 P. maydis Marker 1 kb PCR using pCLY83 based primers

  18. P. sacchari/maize leaf P. sacchari/maize leaf P. sacchari/cane leaf P. phillip.//cane leaf P sorghi/Thailand-2 P sorghi/Thailand-1 infected leaf pt1 infected leaf pt3 maize leaf _Bots P sorghi pt3 P sorghi pt1 P. maydis Marker 1 kb PCR using pMLY12 based primers

  19. This sequence has been used to develop Real Time PCR primers & probe for rapid detection of SDM

  20. Are other regions useful for species comparisons? How about rDNA? -present in many copies per genome -extremely conserved in LS and SS regions -sequences maintained by “concerted evolution” -nontranscribed spacers between units -internal spacers cut out after transcription -data from other species suggest these represent species-specific sequences

  21. 16s rDNA 5 1 26s rDNA 3 ITS1 ITS2 2 4 5.8s Primer sites for conserved fungal ITS primers as described by White, Lee, Bruns and Taylor

  22. Marker P. sorghi Thai2 P. sorghi Thai1 P. sorghi Thai2 P. sorghi Thai2 P. sorghi Thai1 P. sorghi Thai1 P. sorghi Thai2 P. sorghi Thai1 P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 P. sorghi pt1 P. sorghi pt1 P. sorghi pt1 P. sorghi pt1 P. sacchari P. sacchari P. sacchari P. sacchari P. sacchari P. maydis P. maydis P. maydis P. maydis P. maydis flanking PCR Cfo I Hpa II Sau 3AI MspI Fragments detected with P. sorghi rRNA probe

  23. P. sorghi Thai1 P. sorghi Thai2 P. sorghi Thai1 P. sorghi Thai2 P. sorghi pt1 P. sorghi pt1 P. sacchari P. sacchari P. maydis P. maydis M M ITS 1 ITS 2 & 5.8s PCR using conserved ITS primers

  24. Peronosopora sparsa • “downy mildew of roses” • Imported from California? • MS Thesis, Sharon Ross

  25. Peronospora sparsa-specific ITS primers F1 Peronospora sparsa TGGCTGGCTGCTACTGGGC Peronospora tabacini ---------A--G---A-A Phytophthora megakaya --- --T----G-----A Chladosporium sp G--- --GG----C---T Botrytis sp A-A-CTC- -CCT--T-T F7 Peronospora sparsa TATCGCGAGCGTTTGGGCCC Peronospora tabacini -----T-------CT-A-- Phytophthora megakaya ------------------T Chladosporium sp - --AAACT-T-GC-TAA- Botrytis sp -T-T-TT--T --- --G ATG

  26. Nested Primer PCR for Peronospara sparsa ITS

  27. Sclerospora graminicola • “pearl millet downy mildew” • Joint project with ICRISAT • Aparna Viswinathan, MS • Dale Hess, Bamako, Mali • Sivi Siviramakrisnan, India

  28. PCR Amplification of ITS-2 Using Standard Primers 1 1.5 2.5 Magnesium concentration (mM)

  29. ITS Amplification “Oomycete’ Primers OLD NEW

  30. other variable sequences potentially useful for probe development • “COX” spacer between mitochondrial cytochrome oxidase I and II subunits • -tubulin (intron 3 region) (single copy) • Translational elongation factor-1 (intron 4 region)

  31. COX spacer Consensus (P. sorghi) (hits are all Oomycetes)

  32. COX spacers

  33. -tubulin sequence comparisons for maize vs sugarcane isolates

  34. EF-1 base sequence comparisons

  35. Tagging and mapping disease resistance genes in sorghum -Ramasamy Perumal -Seriba Katilé -Clint Magill

  36. Anthracnose resistance Objective: Identify DNA-based markers that co-segregate with gene “Cg1” that confers resistance to Colletotrichum graminicola Tools: AFLP & SSR markers (from BAC contig sequences) Cross: SC748-5 (resistant) by BTx 635 (susceptible)

  37. The AFLP Technique

  38. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 300bp 250bp 200 &204bp 150bp LI-COR system EcoRI-acc/MseI-caa ABI Genetic Capillary System EcoRI-ac/MseI-ca 100bp AFLP amplification products from 14 Peronosclerospora sorghi isolates Lanes: 1. P1(A), 2. P3(A), 3.WHAR.01(A), 4. WHAR.01(B), 5. FUCIK(A), 6. FUCIK(B), 7. CR360(A), 8. CR360(B). 9. CR459(A), 10. CR459(B), 11. MERTA(A), 12. MERTA(B), 13. WES.(A), 14. P NEW 50bp

  39. Segregation for anthracnose resistance and susceptibility in F2 population from a cross between BTx623 (susceptible parent) and SC748-5 (resistant parent) This is a subset of the population tested by Mehta et al. (2005)

  40. F2 progeny selected for DNA analysis Parents: BTx 623 x SC 748-5 (Susceptible) (Resistant) F1 self pollinations Homozygous Homozygous Heterozygous Resistant Susceptible Segregating (29) (29) (13) Disease genotypes of F2 individuals verified in F3/F4 for use in gene tagging These must be correct!! Disease Scoring: College Station 1999 & 2000 College Station 2003 Georgia 2003 College Station 2004 - 4 consecutive weeks data (Dr. L. Prom, USDA)

  41. Cosegregation of AFLP marker Xtxa6227 and the Cg1 locus in F2-3 progeny derived from the cross of BTx623 and SC748-5. AFLP templates from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) and IS3620C (mapping parent) were run as controls to aid in the identification of polymorphic bands. Co-segregation of dominant SSR marker SSR 1 and the cgf1 locus in F2-3 progeny derived from the cross of ATx623 and SC748-5. Genomic DNA from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) were run to aid in the identification of parental alleles for SSR 1. The amplified band from the SSR 1allele was 152 bp (BTx623) or 155 bp (SC748-5)

  42. Relative positions of amplified fragment length polymorphism (AFLP) and Simple Sequence repeats (SSRs) markers linked to gene cg1 in the off-end of linkage group J in a segregating population derived from the cross BTx623*SC748-5

  43. Conclusions • SC748-5 - major dominant gene • AFLP - Xtxa6227 - linked in coupling phase 1.8 cM from cg1 (LG 5) • SSR1- (CT)8 repeat motif- 3.5 cM [5’CCATGAATGGACTCGCTGT3’ & 5’CGGAACAGTAAAACCAACGA3’] - BAC clone [117e5_04 that contains txa455(05)] • First report placing a gene for resistance to Colletotrichum graminicola on the sorghum molecular marker map

  44. Identification, chromosome location, and diagnostic markers for a new gene (Shs1) for resistance to sorghum head smut • Objectives: • Determining the inheritance and chromosomal location of the of sorghum head smut (Sporisorium reilianum) resistance gene Shs1 from BTx635 • Identification of markers linked to the Shs1 using high throughput AFLP technology • Conversion of dominant AFLP marker into STSs/SCARs marker derived by cloning and sequencing specific AFLP marker

  45. Co-segregation of AFLP marker Xtxa 3450 and the Shs locus in F2:3 families derived from B1 and BTx635. The arrow to the left indicates the position of AFLP marker Xtxa 3450 (168.7bp)

  46. Segregation ratio of the F 2:3 families (B1 * BTx635) Markers linked to Shs locus in LG 03 * http://sorgblast.tamu.edu

  47. QTL mapping of downy mildew resistance in maize

More Related