1 / 35

T-RFLP study of soil microbial community at elevated chloride concentration

T-RFLP study of soil microbial community at elevated chloride concentration. M. Gryndler Institute of Microbiology CAS, Prague. In collaboration with:. Miroslav Matucha and Jana Rohlenová, Institute of Experimental Botany CAS, Prague and Jan Kopecký, Institute of Microbiology CAS, Prague.

zia-velasquez
Download Presentation

T-RFLP study of soil microbial community at elevated chloride concentration

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. T-RFLP study of soil microbial community at elevated chloride concentration M. Gryndler Institute of Microbiology CAS, Prague In collaboration with: Miroslav Matucha and Jana Rohlenová, Institute of Experimental Botany CAS, Prague and Jan Kopecký, Institute of Microbiology CAS, Prague

  2. Questions: • Does elevated Cl- concentration affect established soil microbial community? • Does elevated Cl- concentration affect de- -novo developing microbial community? • Which organisms are affected? • Is a change in composition of soil microbial community followed by changes in degradation of chlorinated SOM or chlorination of SOM?

  3. Methodology: • Nonsterile or irradiated/recolonized 128 g soil samples, 20% humidity • Podzolic OH soil from spruce monoculture • Two levels of total soil Cl: 20 or 500 mg/kg • Counting microbial CFU • Extraction of DNA, TRFLP analysis of prokaryotic and eukaryotic ribotypes • 14C-TCA degradation • 36Cl- incorporation into humic substances

  4. Design of the experiment (n=3) • Low chloride, intact microflora • High chloride, intact microflora • Low chloride, sterilized/recolonized • High chloride, sterilized/recolonized

  5. Microbial CFU counts

  6. DNA extraction(125 d) and amplification: Lanes 1,2,3 – 20N Lanes 4,5,6 – 500N Lanes 4,8,9 – 20S Lanes 10,11,12 – 500S Fungi Eukaryotic ITS region, Eubacterial SSU rDNA Eukaryota Eubacteria

  7. Primers: • Eubacteria: 16Seu27f, 783r-a,b,c (Sakai et al. 2004) • Eukaryota: ITS1, ITS4 (White et al. 1990) • Fungi: ITS1F, ITS4 (Gardes and Bruns 1993)

  8. rDNA cassette 5.8S rDNA ITS1 ITS2 D1 D2 18S rDNA 28S rDNA ITS1 ITS4

  9. TRFLP Terminal restriction fragment length polymorphism

  10. Restriction cleavage Restriction profile

  11. A B A+B

  12. Restriction cleavage Restriction profile

  13. Restriction cleavage Restriction profile

  14. A B A+B

  15. A B A+B

  16. Restriction cleavage: • Taq I. restriction endonuclease for eukaryotic DNA • ALU I. restriction endonuclease for eubacterial DNA • Forward primers HEX-labeled • Analysis using capillary electrophoresis, • LIF detector

  17. Terminal restriction fragments:

  18. Numbers of TRF

  19. Effect of soil sterilization/recolonization: • 3 eubacterial and 1 fungal TRF disappeared • 1 eukaryotic and 1 fungal TRF detected

  20. Effect of increased Cl- • 1 eubacterial and 1 fungal TRF disappeared • 1 bacterial and 1 eukaryotic TRF detected

  21. Eukaryotic TRF 135 bp Absent from any treatment but nonsterilized soil high in chloride In 3 replicates constitutes 33.5, 11.4 and 7.0 molar % of all TRF !

  22. Identity? Forward primer 5´- ITS1 - ............. TRF……....….......... T– 3´ 3´- ................. 2-stranded .......... A GC– 5´ =TaqI Fragment lacks known reverse primer sequence Oligonucleotide adapter is necessary for PCR amplification

  23. Identity? Forward primer 5´- ITS1 - .......……TRF………….......... T– 3´ 3´- ................. 2-stranded .......... A GC– 5´ =TaqI Forward primer 5´- ITS1 - .............TRF.......................... T/CG AAT TCT CCG TCT CGC TCC G – 3´ 3´- ................. 2-stranded .......... A GC/TTAAGA GGC AGA GCG AGG C – 5´ =TaqIreverse primer

  24. Identity? 5´‑TCCGTAGGTGAACCTGCGGAAGGATCATTGGAGAGAGAAAGGGGGAGAGAGTTGGAATGTGATGAGACGAGAGATTCAAACTATATAGTGAATGATCATACAACTGCTGACAATGGATCTCTGGGCTCTTGCGTCGAATTCTCCGTCTCGCTCCG-3´ This sequence is 100% identical with the sequence registered in GenBank under accession number DQ309135 ("uncultured fungus isolate RFLP-145") and involves a part of 18S ribosomal RNA gene and a part of internal transcribed spacer 1. This sequence was amplified from DNA extracted directly from Ericaceous roots along a moorland-forest gradient in Scotland. At this stage, its identity is unknown (Prof. John W. G. Cairney, University of Western Sydney, Australia, personal communication).

  25. Identity? 5´‑TCCGTAGGTGAACCTGCGGAAGGATCATTGGAGAGAGAAAGGGGGAGAGAGTTGGAATGTGATGAGACGAGAGATTCAAACTATATAGTGAATGATCATACAACTGCTGACAATGGATCTCTGGGCTCTTGCGTCG-3´ Sequence does not contain information sufficient to identify its bearer. However, it may be used to design specific primer to amplify larger rDNA fragments, perhaps suitable for identification by „BLASTing“

  26. Primer CLF1 (forward) • 5´-GAGTTGGAATGTGATGAGACG-3´ + Primer NL4(reverse)

  27. rDNA cassette 5.8S rDNA ITS1 ITS2 D1 D2 18S rDNA 28S rDNA CLF1 ITS4

  28. ITS1F-ITS4 ITS1-ITS4 27f-783r CLF1-ITS4

  29. rDNA cassette 5.8S rDNA ITS1 ITS2 D1 D2 18S rDNA 28S rDNA CLF1 NL4

  30. CLF1-ITS4/NL1-NL4 GAGTTGGAATGTGATGAGACGAGAGATTCAAACTATATAGTGAATGATCATACAACTGCTGACAATGGATCTCTGGGCTCTTGCGTCGATGAAGAACGCAGCAAAACGCGAAAAGTGTTATGATGTGCAGTCTTTGAGAATCATGAATGTTTGAACGCACCTTGCACCACCGAGCGATTGGGGGTATGCCTGTTTGAGCGGGGGATAAAATTGAGTGAACTGTGGTTTATTGTGGGGTACTAGGTAACACCTTGCCCTGAAAGACAGATCTCGTGTACTCTTGGGATAATCCATCAAGAAGCACATTTACAGTATACCACCTCAAATCAGGCAAGATGACCCGCTGAACTTAAGCATATCAGTAAGCGGAGGAAAAGAAACTAACCAGGATTCCCGCAGTAACGGCGAGTGAAGAGGGAACAGCTCACATTTGGAAACGATCATGAAAAAAGTGGTCGAGTTGTCAGTGATAGCATGGGAGCGGGATTTGGAAAGGGTGAGCGAGTCTGCTGGAAAGCAGCGCCAGAGAGGGTGACAGCCCCGTGGCTTGCCTTGCACAAGTTTACGGAGCCATGCGACGAGTCGGACTGTTTGGGAATGCAGTCCTAAATGGGTGATACGTGTCATCTAAAGCTAAATAGCGGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTCTTGGCAGAGAGTGAAAAGTGCGTGAAATTGTCAGCAGGGAAGCGATGGTGGTGGGGAGGTGTGCCAAGAGAAGCAACTTCGTCAGAAGTTGCCAATTAAAAAGCACGAGCGAGGCGAGTGGATGAGGGGGAAGATAGGTGGGAAGAGAGAGTAATTCATTACAATTTCTTCAAACTAAACCCCCCACACACACCCACCTCGCAGCCCACCACGACCGACCCGTCTTGAAACACGGACC

  31. Homology? Glomus walkeri(AJ972467, E=1x10-36), Glomus drummondi(AJ970465, E=4x10‑36) Orpinomyces sp.(AJ864475, E=2x10-36) Entophlyctis sp.(DQ273782, E=6x10-36) Cyllamyces aberensis(DQ273829, E=2x10-35) Neocallimastixsp. (DQ273822, E=2x10‑35)

  32. Efects of increased chloride on organic and inorganic Cl-?

  33. Efects of increased chloride on organic and inorganic Cl-? 36Cl-TCA mineralization

  34. Efects of increased chloride on organic and inorganic Cl-?

  35. Conclusions • Sodium Chloride at „realistic“ concentrations affects soil microflora • TRFLP and downstream techniques can be used to detect and identify organisms responding to chloride • Inorganic and organic Cl behaviour is affected by Cl- concentration • Links between specific organisms and soil Cl fluxes are probable

More Related