1 / 65

Biology Resources

Biology Resources. Set 2: Answers for Structured Note-Taking. Living thing-organism 5 Characteristics: 1. Cells & DNA 2. Reproduce 3.Grow & Develop 4. Homeostasis 5. Adapt. 1. Cells & DNA Cell- basic unit of life DNA- genetic info 2. Reproduce *to further the species 3.

zinna
Download Presentation

Biology Resources

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Biology Resources Set 2: Answers for Structured Note-Taking

  2. Living thing-organism 5 Characteristics: 1. Cells & DNA 2. Reproduce 3.Grow & Develop 4. Homeostasis 5. Adapt 1. Cells & DNA Cell- basic unit of life DNA- genetic info 2. Reproduce *to further the species 3. 4. homeostasis *internal balance (kidneys sweating) Without it, you will die! 5. Adapt Adaptation: help you survive in environment Evolution: change in species over time Biology- The study of living thingsWho: Biologist- Interactions between living things- Interactions between living things and the environment- Problems to find solutions 5

  3. SCIENTIFIC METHOD- a series of steps to solve a scientific problem 1. Problem 2. Hypothesis 3. Experiment 4. Data 5. Results 6. Conclusion 7. R/R or Repeat ----------------------------------- 1. Problem- scientific * Cannot be opinion * Give ex of opinion vs scientific 2. Hypothesis- a testable statement *give example 3. Experiment -a test of a hypothesis Independent variable: tested Dependent variable: measured Constant: same Control: normal to measure against 4. Data- info collected 5. Results- charts/graphs 6. Conclusion 7. Revise / Redo or Repeat -R/R- hypo wrong - Repeat- hypo right Why repeat: to verify results 7

  4. WATER Properties: Polar- Great solvent --Like dissolves like-- --Polar dissolves polar-- Non-polar= oils, fats - will not dissolve Hydrogen Bonds: - gives H2O special properties - make/break rapidly 3 Things H2O does: 1. Capillary action Good- H2O to tops of trees 2. Stabilizes temp, holds heat (Good) NC ocean- mild climate Desert- hot day, freezing night 3. Expands when freezes – less dense Good- floats Water does these things because of Hydrogen bonds Water is Polar

  5. ACID pH: 1-7 Gives- H+ burns Ex: lemon juice, stomach acid BASE pH: 7-14 Gives- OH- Soapy, cleaning Ex: cleaners, ammonia 7 Maintains constant pH Ex. Blood buffer Neutral H2O pH scale Buffer

  6. Organic = has Carbon Living things have C [S]-[U]-[G]-[A]-[R] CARBOHYDRATES Polymer- polysaccharide Monomer- monosaccharide Uses  quick Energy Ex. Starch, sugar, fiber Foods plant products/ fruit, veggies ORGANIC • Polymer • long chain of repeating units • Ex.train • [o]—[o]---[o]---[o] • Monomer • one unit • Ex. Train car • [o] 4 P R O T E I N (A)-(M)-(I)-(N)-(O)-(A)-(C)-(I)-(D) Polymer- polypeptide (protein) Monomer- amino acid Uses  hair skin enzymes Food  animal products, beans Ex. Enzymes (go to enzyme side) • Carbs • Protein • Nucleic Acid • Lipid Classes of organics

  7. Nucleic Acid Enzymes • A type of protein • Subunit of protein amino acid • Job- “Biological Catalyst” • Affected by: temp & pH • Needed for: Biological Functions • Lock and Key Model • E are not consumed/used • In out Monomer- nucleotide Ex. – DNA/RNA Importance  genetic info • LIPID • fats and oils • nonpolar • Meaning  will not dissolve in H2O • Found in  mayonnaise, butter • Greasy, oily

  8. Before Microscopes: sick because cursed or punished for bad deed • Microscope Types: • Simple light – 1st type • 1 lens Energy Source light • LOW magnification power • 2. Compound Light • 2+ lenses Energy source light • Lens= 10 Objective = 4 • Total Magnification = 40 • Up to about 1500 X’s • Electron Microscopes • Uses beam of electrons • Magnify up to 500,000 X’s M I C R O S C O P E S • Microscope  • tool used to look at small • organisms Micro – small Scope –to look at Microscopes allow US to see cells! Cell basic unit of life • SEM • scanning e-microscope • surface • TEM • transmission e-microscope • inside

  9. Parts: Objectives, Diaphragm, Lens, Coarse Adjustment, Light Source, Arm, Stage, Fine Adjustment Match the part with the letter • Fine Adjustment E. Stage • Lens F. Diaphragm • Light Source G. Objectives • Coarse Adjustment H. Arm Answer Questions using Parts 1. __D__Used to bring objects into rapid focus first 2. __F__ Regulates the amount of light going through slide 3. __H__ Used to carry the microscope 4. __E__ Supports the slide 5. __A__ Turned to clear blurry pictures Answer Questions: How do you carry a microscope?- by the arm If the lens is 10 and the objective is 4, what is the total magnification?- 40

  10. Famous Men Leeuwenhoek: saw microorganisms Used a simple microscope Robert Hooke: named a cell Used a compound microscope Looked at cork- Reminded him of rooms in a monastery Called cells T. Schwann: sounds like Swan All animals made of cells M. Schleiden: All plants made of cells Since all plants and animals are made of cells they concluded that… Hooke , Schleiden , Schwann Cells Plants Animals CELL THEORY 1. All living things are made of cells unicellular- 1 cell multicellular- 2+ cells 2. Cell is the basic unit of life The beginning unit is always a cell 3. All cells come from other cells CELLTHEORY cells organ organisms Organ system tissue muscle skin muscle skin skin muscle

  11. Plasma Membrane Structure PLASMA MEMBRANE Polar head Tails non-polar (hydrophobic) • Plasma Membrane  outer boundary of a cell - skin • Job- to maintain homeostasis • Homeostasis  internal balance • PM is selectively permeable • selectively- choosy • Permeable – allows to pass • Selectively permeable  chooses what it allows to pass phospholipids bilayer Polar: heads outside Non-polar: tails inside hiding from H2O Fluid mosaic model flexible  Embedded w/ protein PM Perm mem Good in balanced nucleus Bad out

  12. Cell organelles  organs in a cell “organelle“ Most important = nucleus Nucleus  controls all cell function Nucleus:Cell :: brain:body 2 Cell Types Prokaryote Eukaryote CELLS nucleus • no nucleus • no int membrane • simple • 1 job at a time • bacteria only • nucleus • int membrane • complex • multitask • plants/animals Animal cell Internal Membranes separate the cell into compartments Membranes : Cell :: walls: School Jobs – separate -divide -allow to multiply prokaryote eukaryote

  13. Cell Theory • All living things made of • cells • 2. Cell is basic unit of life • All cells come from • pre-existing cells Plasma Membrane CELLS Plasma membraneis tocellas Skinis tobody RF: center covering Job: homeostasis Structure: phospholipids bilayer “ fluid mosaic model” Prokaryote Eukaryote Polar heads outside Nonpolar tails inside away from water • simple • no nucleus • no interior membrane • complex • nucleus • int membrane Other Cell Organelles Cell wall hard exterior covering Made of: cellulose Gives: extra protection Note  plants only Nucleusis tocellas Brainis tobody Nucleus: controls all cell function Cell wallis tocellas Helmetis tohead Relating factor: Int memis tocellas Wallis toschool Internal Membrane: separate cell into rooms RF: hard protection RF: divide

  14. Ribosome: • 2 types: • free • bound • Job  make protein • *You can’t live without PROTEIN* Vacuole: Description- empty sac job- store food, H2O NOTE  plant cell larger Vacuoleis tocellas Fridge is tohouse ribosomeis tocell as Protein factory is tocity RF: stores • Mitochondria: • makes energy • ATP • *You can’t live without ENERGY!!* RF: makes protein Mitochondriais tocellas Battery is toobject Chloroplast: Description- green job- make food/ photosynthesis Chlorophyll- traps sunlight NOTE  plants only RF: energy Chloroplastis tocellas Kitchen is tohouse ATP • Eukaryotes: • Have membrane bound organelles • Have nucleus • Prokaryotes: • Have plasma membrane • Have DNA • Have Ribs • b/c  must have protein RF: room to make food

  15. Concentration: Amount of solute in solution. Think kool-aid Highlow Lots of solute not enough solute Solute (green) will move from high to low Goal: Concentration Dynamic Gradient Equilibrium DIFFUSION • difference in conc on sides • 7/3 • equal • 5/5 A B A B A B To side A A Solute (green) will move to B (think elevators and buffet lines. Where would you rather be?) B A B To side B

  16. Remember Diffusion  movement of a solute to low (less crowded) Driven by: concentration gradient Result: DE Which side needs to be diluted? A So water will go to side A OSMOSIS • Review concentration: (think kool-aid) • HighLow • Too much not enough • Dilute  add water to lower conc. • OSMOSIS • movement of water to high • Why: to dilute • Driven by: CG • Result: DE More water on side A because more particles Water will move to side B Why? To dilute high

  17. Water will move to side A Why? To dilute CELLOSMOSIS Plant • Where is there more? in • So water flows? in • Results: swells • Puts pressure on inside wall More : out Water flows: out Result: shrivels Sides: equal So: no flow Result: no pressure 9 3 Animal Water Flows 2 6 3 3 8 2 4 Cell

  18. Passive • no energy • Happens because there is a • Concentration gradient • Result- dynamic equilibrium • 1. Diffusion • 2. Osmosis • 3. Facilitated Diffusion • Active • uses energy • Requires energy to: move against conc grad • Result: more unequal • 1. pumps • 2. carriers • 3. endocytosis, exocytosis TRANSPORT A B Passive: to side B Active: pumped to side A

  19. Cell cycle  cycle for cells to make new cells • “All cells come from pre-existing cells”  Cells must reproduce DNA in cells  chromatin • unpacked • chromosome • packed DNA • visible when stained Cell cycle: 1. Interphase: grow & DNA duplicate 2. Mitosis: nucleus divides 3. Cytokinesis: cut cell in half MITOSIS centromere Sister chromatids

  20. # 1 Source of energy- sun Cell energy- ATP “Adenosine Triphosphate” A – P – P – P Release Energy break bond Store Energy  make bond Remove –P leaves A–P-P (ADP) Remove –P leaves A – P (AMP) Which has more energy? ATP Why? More P-P bonds *Made in the mitochondria • Photosynthesis • Who plants • Where chloroplast • Job- to make food + O2 • Plants take In Out • CO2 -O2 • water H2O -food • sun E • Reactant in Product out • Eq: 6CO2+6H2O+E6O2+C6H12O6 ENERGY Sun  chemical  food E E E C6H12O6

  21. Cellular Respiration Where  mitochondria Job  to make ATP • In • O2 • C6H12O6 • Out • CO2 • H2O • E-ATP Also called fermentation Reactant IN Product OUT Eq: 6O2+C6H12O6  6CO2+6H2O+E Notice: Products of PS are reactants in CR Lactic Acid Fermentation  CO2 Alcoholic Fermentation  O2 food Cellular respiration photosynthesis

  22. Chemistry and Cell Review “polar“ Acid Base pH 1-7 H+, burns pH 7-14 OH-, cleans • Parts of cell theory • all living things made of cells • the cell is the basic unit of life • all cells made from pre-existing cells

  23. Cells basic unit of life Cell  tissue  organ  organ system organism Cell Parts Nucleus– control Plasma Membrane- outer covering Mitochondria- energy Chloroplast- food- photosynthesis Ribosome- protein Vacuole- store food

  24. A B Water will flow to A Why- needs to dilute Result- dyn eq Process- osmosis Solute will move to B Why- less concentrated Result- dyn eq Process- diffusion 7 3 5 2 Water goes: in - swell 8 Water goes: out - shrivel 5 Water goes: no flow - stable

  25. Tele Meta Mom Ana Prop A B C D E F Place the phases in order: D A F C E B and name them mitochondria Cell Energy  ATP Adenosine triphosphate - Energy stored in P-P bonds Cellular Respiration We breathe in O2 We eat C6H12O6 We breathe out CO2 Make H2O + ATP Anaerobic No oxygen, less ATP fermentation Photosynthesis IN OUT H2O, CO2, E O2, C6H12O6 Eq: 6CO2+6H2O+E6O2+C6H12O6 Chloroplast Aerobic Oxygen, more ATP

  26. DNA – deoxyribonucleic acid • Codes for  genetic info • Gives info to make protein • Importance of protein: • can’t live without protein • codes for traits (eye color, hair) • DNA is very important information Where  nucleus • Question- An enzyme helicase cuts segments of DNA to repair damaged cells. Where in the cell is this enzyme located?  nucleus Structure Polymer = DNA -long chain of joining subunits Subunit  nucleotide Nucleotide (3 parts) 1. Sugar deoxyribose 2. phosphate 3. Nitrogen bases (4) Nitrogen bases (4) 1. Adenine A 3. Cytosine C 2. Guanine G 4. Thyamine T Purines pyrimidines D N A G E N E T I C C O D E Note DNA cannot leave nucleus Ad Gua Cy Thy

  27. Important structure note: • DNA is a double helix • Watson & Crickmen • 2 strands • Like a ladder Bases always held together by hydrogen bonds So DNA looks like this Backbone S-P-S-P backbone Repeating  S-P-S-P-S-P Bases held together by hydrogen bonds Nitrogen bases A-- G-T- C- A-- T-- ?-- --T --C --A --G --T --A Complementary bases they always go together A= T C= G Hydrogen bonds Make the DNA complement

  28. R E P L I C A T I O N • Review • Make the complement: • ATCTAAGCAGGTA • TAGATTCGTCCAT • TACGGATACCGAAT • ATGCCTATGGCTTA • How: • Enzyme splits it • Complement strands made • Result  Replication makes a copy Replication DNA synthesis make DNA DNA codes for protein Proteins made on ribs Problem  DNA cannot leave nucleus Info must get to the nucleus Solution RNA Word Attack: Synthesis  to make Replication makes a copy Why for new cells When  interphase Where  nucleus

  29. Review: • RNA – ribonucleic acid • 1 Strand • Nucleotide (3) • Sugar ribose • phosphate • Nitrogen base • * A *G *C * U (uracil) • A  U • C  G • Made by transcription Transcription DNA- ATCGTATCA RNA- UAGCAUAGU DNA- TACCGATCCCATC RNA- AUGGCUAGGGUAG DNA- GACCCGTCATCCGGTAATAATCCAT RNA- CUGGGCAGUAGGCCAUUAUUAGGUAU DNA RNA . R N A • deoxyribonucleic acid • 2 strands • deoxyribose sugar • Bases A=T G=C • made by replication • cannot leave nucleus • ribonucleic acid • 1 strand • ribose sugar • bases A=U C=G • made by transcription • nucleus- ribosome Transcription  Makes RNA from DNA Where: nucleus

  30. Review: DNA RNA . Bases- AT, CG Bases-AU, CG Process- replication Process- transcription P R O T E I N • How to find out what amino acids to use: • Use chart • Use codons • Codon set of 3 nb used to code for AA • Let’s Practice! • CAU – His • UUU –Phe • UUA – Leu • GAA – Glu • CCC – Pro • CGC – Arg • Does chart use RNA or DNA? RNA • So If you have CAT? GUA Job  to make protein Protein  a long chain of amino acids Process  translation Translation to make protein by joining amino acids

  31. Remember DNA RNA . T R A N S L A T I O N • deoxyribose • 2 strands • AT CG • replication • cannot leave nucleus • ribose • 1 strand • AU CG • transcription • nucleus- ribosomes • Protein monomer amino acid • Codon: set of 3 nb • Translation  make protein • Ex: ACU I GUU I CAU • Divide into 3’s • 2. Find amino acid on chart • Protein  Thr – Val – His • Ex: • TAC GAA CCC GTA CAA ACT –DNA • AUG CUU GGG CAU GUU UGA -RNA • protein A = T(DNA) A = U(RNA) C= G 3 parts of a nucleotide: 1. sugar 2. phosphate 3. Nitrogen base Replicate: ATCCATGAACTATAG TAGGTACTTGATATC Transcribe: ATCCATGAACTATAG UAGGUACUUGAUAUC 3 types RNA: 1. mRNA: messenger 2. tRNA: transfer 3. rRNA: ribosomal

  32. M U T A T I O N • THE DOG BIT THE CAT • THE DOG BIT THE CAR • TED OGB ITT HEC AT_ • 1  Point-Substitute: changes 1 amino acid • 2  Frameshift: delete/insert. Changes all amino acids • Review: • Make the DNA complement: • CATGACTTAATGCGA • GTACTGAATTACGCT • 2. Transcribe: • CATGACTTAATGCGA • GUACUGAAUUACGCU • Translate: • CAT GAC TTA ATG CGA • GUA CUG AAU UAC GCU • RNA • mRNA- MESSENGER • tRNA – TRANSFER • rRNA – RIBOSOMAL

  33. DNA Mini Lab • Normal hemoglobin vs. Sickled hemoglobin • Normal hemoglobin carries oxygen • Sickled hemoglobin cannot carry oxygen • Why  They make different proteins • Job: Transcribe and translate the DNA of the 2 types of hemoglobin • Normal: GGG CTT CTT TTT • Sickled: GGG CAT CTT TTT • Using AAT GCC AGT GGT TCC CAC • what protein would it make? • Contrast replication, transcription and translation: • Contrast RNA and DNA: • What are the 3 parts of a nucleotide?

  34. GENETICS Father of Genetics: Gregor Mendel Gene: segment of DNA that codes for a protein/trait Allele: choices for a trait/gene Ex: gene- eye color gene- height Alleles- brown, blue alleles- tall short Heredity: passing of traits from parents to kids Genetics: study of heredity Traits: characteristics you get from parents Gametes: sex cells MomDad Egg sperm Fertilization- union of sperm and egg Zygote – fertilized egg Dominant Recessive Always seen T Can be hidden and skip generations t Law of Segregation: Get 1 allele for each trait from each parent So you end up with – 2 alleles for each

  35. How do you predict what offspring will look like? • Punnet Square • Tool used to predict genotype and phenotype of offspring • B=black b=tan • Mom - Bb Dad- Bb • Looks black Looks black • Cross parents • Bb x Bb • mom dad • Draw box • Put mom gametes on top. Put Dad gametes on side. • Fill in box with a letter from each parent • Analyze Since you have 2 alleles for each gene, you have 2 letters (Remember baby lab) TT  homozygous dominant (Tall) Tt  homozygous recessive (short) Tt  heterozygous (tall) Big letter ALWAYS wins Genotype Phenotype Combo of alleles Tt Bb Physical trait Tall, short B b B b

  36. Pair up letters in the following combinations • BbTt • 1234 • 1,3 1,4 2,3 2,4 • BT Bt bT bt • Dihybrid Crosses • 2 different traits/parent • B = brown b = white • T = tall t = short • BbTt – brown tall • Bbtt - brown short • bbTT - white tall • BBtt - white short • Rules for dihybrids • Ex: BbTb x Bb TT • Label mom and dad • Mom- BbTt dad BbTT • 2. Take mom and label letters 1-4 • BbTt • 1234 Notice: never 2 of the same letter in a pair • Repeat for Dad • BbTT • 1,3 1,4 2,3 2,4 • BT BT bT bT • 5. Draw Punnet square • How many squares will you have? • BbTt x BbTT • 4 X 4 = 16

  37. Square: 4 across, 4 down Q1: T – tall t – short R – round r – white TtRR x TtRr • Place Mom’s 4 combos on top • Place Dad’s 4 conbos down side • Fill in boxes • Each box will have 4 letters • Using our example how many offspring will be: • BBTT: 2 BBTt: 4 • bbTt: 2 BbTt: 4 • BbTT: 4 • Brown tall: 12 white tall: 4 How many are tall round? 12 What are the genotypes? TTRR TtRR TTRr TtRr ttRR ttRr Remember combos: 1,3 1,4 2,3 2,4

  38. G E N E T I C T E C H N O L O G Y • Uses: • Forensics • DNA obtained from: • If know DNA sequences: • Other uses of Genetic Technology: • Industry • Medicine • Agriculture

  39. Pedigree: a genetic family P E D I G R E E female male How is person 7 kin to person 1? Son InLaw How are 6 and 9 kin? Aunt/nephew How is 1 kin to 13? Great grandson How many males? 6 Females? 7 How many affected people? 5 Males? 3 Females? 2 If trait studied is tt – short: Give the gen/phen for each person 1 Tt tall 8 tt short 2 Tt tall 9 Tt tall 3 Tt tall 10 Tt tall 4 Tt tall 11 tt short 5 tt short 12 Tt tall 6 Tt tall 13 tt short 7 tt short Persons _5,7,8,11,13_ are short affected affected married children carrier Carrier: Tt – carries the t but is not affected by it

  40. Recessive Diseases: • Cystic Fibrosis: • Buildup of mucous in lungs • Pedigree: • Note: only child affected • For a recessive disease to affect a child both parents must be: carriers Practice Pedigrees: Which people are affected? 3, 6 Label each person bb- blue BB or Bb - brown This is a recessive pedigree Because  2 unshaded parents have an affected child Most genetic disorders are caused by: 2 recessive alleles Carrier: carries the allele but are not sick Cc What % Chance will 2 carrier parents have a sick child? 25%

  41. H U M A N T R A I T S • Most genetic disorders are caused by 2 recessive alleles • Cystic Fibrosis: • A buildup of mucous in lungs • Affects mostly children • Tay-Sachs • -affects the brain • -Cannot break down lipid/fat • -Mostly affects children • PKU • -found in protein • -cannot digest protein • - Controlled by diet • Dominant Traits: • Hitchhiker thumb • Unattached ear lobes • Thick lips • Huntington’s Disease: • Causes brain degeneration • Affects people 35 to 45 • Why do people with Huntington’s have children not know they are sick • If you carry the gene for Huntington’s you are affected by it • H = has it h = does not

  42. If a child with free hanging earlobes has a mother with attached earlobes, could a man with attached earlobes be the father? No • Why? No big F’s to give • F = free f = attached • 6. • 1. Which is Huntington’s? A • Which is cystic fibrosis? B • How do you know? • How is Huntington’s different? Older age, dominant • Define the following: • What body part is affected by CF? lungs male female # affected: 6 How are 9 and 6 kin? aunt Gen/phen of person: 2 ff att 7 Ff 3 Ff 9 Ff 4 ff att 11 Ff 13 ff att married carrier

  43. Blood Type- codominance and multiple alleles Multiple alleles  more than 2 choices TypeGenotype A IA IA IA Ii B IBIB IBi AB IAIB O ii Who did the blood bank  Charles Drew blood transfers If a son has blood type O could a msn with blood type B be Dad if the Mom has A? What % chance do an A (Ia,i) woman and a B (Ibi) man have of having an O child?

  44. Humans have 46 Into 23 pairs Karyotype  chart of paired chromosomes C H R O M O S O M E S Chromosomal Diseases: Down’s Syndrome  3 on 21st pair -mental and physical retardation D-S male 23 23rd pair - sex chromosomes XX - female XY - male The chart shows a normal female Monosomy 23 female copy

  45. Sex-linked diseases Female – XX Male - XY Travel on the X Red/Green colorblindness Hemophilia: bleeder. Cannot clot blood Pedigree: Notice: mom is carrier. Passes it to sons More males affected Why? FemaleMale XxX XxY Can a carrier female and an affected male have an affected daughter? Can a normal female and an affected male have an affected daughter? 0 Son? 0 Where does a son get his bad X? mom Who does dad give his bad X to? daughter Good X takes over Only 1 X and it’s affected

  46. O R I G I N O F L I F E • Primitive Earth • Deadly Gases • Oparin Hypothesis • 3.9 billion years ago  • This caused  • 2 things happened: • 1. • 2. • Lightning and carbon in ocean formed: • These combined to form _________ • Protocell (organic)  _________ (simple)  ___________ (complex) Primitive Earth: NO LIFE How did life begin?

  47. Evidence for Evolution • Fossils- oldest _________ • fossil record  • Biochemistry – • Embryology – • Anatomical Structures • similar vestigial • Urey and Miller • Can Oparin be for real? Urey and Miller tested him. How? • Result  they found … • Urey and Miller support Oparin • Hypothesis  • Where: in the __________

  48. ECOLOGY Ecology: the study of organisms and their environment Who? ecologist Biotic factors abiotic factors 1. Organism - 1 living thing Ex. 1 giraffe 2. group - 2+ of same species Ex.giraffes 3. community - 2+ different species Ex. Zebras and giraffes 4. ecosystem - Living and nonliving Ex. Zebra, giraffe, tree, and sun 5. biosphere - Can support life Ex. Sphere = circle Bio = life EARTH! Living Plants, animals, predators Nonliving Sun, dirt, temp 5 levels of ecology: 5 • organism • population • community • ecosystem • biosphere

  49. Interactions: • Competition- fighting over resources • Habitat Niche . • Where it lives • Ex. In a tree • Reduces competition: by having organisms w/ diff niches/needs • Predator/Prey • Predator: eats • Prey: gets eaten • Cyclic • Prey up, predator up, then prey gets eaten, levels down, predator down from lack of food, then back to beginning as prey makes comeback • Density dependent  depends on size of population • Symbiosis  living together, nothing dies • Mutualism: 2 (both) benefit •   • Ex. Fish in coral • Commensalism : 1 benefit, 1 unaffected •  :l • Parasitism: 1 benefit, 1 harmed •  • Ex. Leeches on a host What it does- job Ex. Collect acorns

More Related