220 likes | 349 Views
Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules?. The Need for Protein Making Instructions Phenotype = genotype (+ environment)
E N D
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production • Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • RNA is single stranded, difft sugar, uracil • How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices • Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons • Steps of Translation (Protein Synthesis) DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
Flow of Genetic Information Figure 8.2
DNA Figure 8.4
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production • Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • RNA is single stranded, difft sugar, uracil • How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices • Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
DNA Replication is Semiconservative Figure 8.3
DNA • DNA replication is semiconservative Figure 8.7
DNA Replication Involves Several Enzymes Figure 8.6
DNA Genes are Instructions for Making Specific Polypeptides Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes Genotype: The genes carried in a cell for a particular trait A segment of DNA (gene) carries specific coded instructions for the making of a single proteins. Phenotype: The physical expression of genes for a particular trait
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production • Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • RNA is single stranded, difft sugar, uracil • How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices • Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
Translation or Protein Synthesis Figure 8.2
Anatomy of a Messenger RNA mRNA is a Chain of Nucleotides Trailer Leader Figure 10.17
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production • Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • RNA is single stranded, difft sugar, uracil • How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices • Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
3 Types of RNA – Each With a Different Job Messenger RNA (mRNA) Carries copy of gene information to the ribosome to make protein anticodon Transfer RNA (tRNA) CUG = C U G Carries amino acids to the ribosome for linking; identified by anticodon “sign” Part of the structure of the ribosome; key component in amino acid linking machinery Ribosomal RNA (rRNA)
Central Dogma: DNARNAProtein DNA template strand: CGTTTACGACCGGCCTTAGATCCTGACG Transcription by RNA polymerase mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC Translation by ribosome Protein: Met - Leu - Ala - Gly - Ile
Translation in Prokaryotes Can Occur Simultaneously With Transcription Figure 8.11
Translation: Initiation, Elongation, Termination Initiation Elongation (3-4 steps) Termination
Steps of Translation Protein Synthesis Movie