170 likes | 305 Views
Designing and Building a Bacterial Computer. RECOMB-BE. laheyer@davidson.edu. Dr. Laurie J. Heyer. July 20, 2011. Synthetic Biology.
E N D
Designing and Buildinga Bacterial Computer RECOMB-BE laheyer@davidson.edu Dr. Laurie J. Heyer July 20, 2011
Synthetic Biology Application of engineering principles and mathematical modeling to the design and construction of biological parts, devices, and systems with applications in energy, medicine, environment, and technology.
Hamiltonian Path Problem Is there a path that: • Starts at node 1 • Ends at node 7 • Visits each node exactly once 3 2 4 1 YES 5 7 NO 6
Hamiltonian Path Problem Is there a path that: • Starts at node 1 • Ends at node 7 • Visits each node exactly once 3 2 4 1 YES 5 ✔ 7 NO 6
A Biological Computer Node = gene Edge = 2 half-genes 1 2 3 4 5 6 7 GFP BLa CAT Cre cFP T7 TT 4 1
A Biological Computer Use hin/hix to rearrange edges: Hinrecombinase from Salmonella typhimurium
A Biological Computer Use hin/hix to rearrange edges: Hinrecombinase from Salmonella typhimurium
Identify Solutions 1 4 5 2 3 6 Terminate GFP Cre cFP CAT T7 TT BLa # True Positives = (e - v + 1)! * 2(e - v + 1) # False Positives = ?
Splitting a Gene Reporter ✔ Detectable Phenotype RBS Promoter ✔ Detectable Phenotype? Repo- rter RBS hixC Promoter ✖ Detectable Phenotype? Repo- RBS rter hixC Promoter
Minimize Structural Disruption GFP displaying hixC insertion point
Gene-Splitting Strategy GFP-1 GFP-2 http://gcat.davidson.edu/iGEM07/genesplitter.html
Gene Splitter Output Note: Oligos are optimized for melting temperatures.
Embed hixC With Silent Mutations hixC = ttatcaaaaaccatggtttttgataa L S K T M V F D X Y Q K P W F L I X I K N H G F * * ^ ^ ^ ^ ^ ^ ^ ^ Find genes with the “best” match to one of: L S K… … V F D a a tY Q K… … F L I a L S K … V F D a a t Y Q K … F L I a
Conclusion • Synthetic biology is an emerging bioinformatics playground • Biology is more efficient with automation • Existing tools are insufficient • Learn programming (Perl, Python, etc.) • Learn algorithms and data structures • Think and work across disciplinary boundaries
Acknowledgements Malcolm Campbell (Biology, Davidson College) Todd Eckdahl, Jeff Poet (Missouri Western State Univ.) iGEM’06 team: Lance Harden, Karmella Haynes, SabriyaRosemond, Samantha Simpson, Erin Zwack iGEM’07 team: OyinadeAdefuye, Will DeLoache, Jim Dickson, Andrew Martens, Amber Shoecraft, and Mike Waters Karen Acker ’07 Phillip Compeau’08 Funding from HHMI, Davidson College, Missouri Western State University, NSF UBM DMS-0733952 and -0733955