1 / 40

Using Zinc Finger Nucleases to Manipulate the Mammalian Genome

Using Zinc Finger Nucleases to Manipulate the Mammalian Genome. Matthew Porteus UT Southwestern Medical Center Depts. of Pediatrics and Biochemistry Dallas, TX. Gene Targeting is a Precise Recombination Event.

Albert_Lan
Download Presentation

Using Zinc Finger Nucleases to Manipulate the Mammalian Genome

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Using Zinc Finger Nucleases to Manipulate the Mammalian Genome Matthew Porteus UT Southwestern Medical Center Depts. of Pediatrics and Biochemistry Dallas, TX

  2. Gene Targeting is a Precise Recombination Event Definition: Gene targeting is the replacement of genomic DNA with exogenous DNA by homologous recombination. Commonly Used For Experimental Purposes in certain cell types (yeast, chicken DT40 cells, murine embryonic stem cells) In addition to its usefulness for mammalian somatic cell genetics, it could also be an ideal way to treat genetic diseases.

  3. 37GFP-IRES-CD8 CMV-Sce 37GFP-IRES-CD8 Stop-Sc e Site GFP Gene Targeting System CMV/CBA-GFP*-IRES-CD8a-PGK-Neo Stop-Sce Site

  4. DSB-Induced Gene Targeting CMV/CBA-GFP-IRES-CD8a-PGK-Neo Optimized Rate=3-5% (30-50,000 events per million transfected cells) Porteus and Baltimore (2003)

  5. Two Components forDSB-Induced Homologous Recombination Repair Substrate: Fragment of DNA that serves as template for repair of DSB by homologous recombination. Nuclease: Enzyme to create DSB in target gene.

  6. Schema of DSB-Induced Gene Conversion S Undamaged DNA (Allele S) DSB Created (spontaneous or induced, e.g. by ZFN ) Strand Invasion into Undamaged Homologous DNA (Allele A) In gene targeting exogenous DNA serves as homologous DNA donor. Repairing of original strands of DNA. Gaps filled by DNA polymerase and nicks sealed by DNA ligase. Conversion of Blue Allele(“S”) into Red Allele (“A”) in region of DSB A A

  7. Endogenous Genes Do Not have Recognition Sites for Homing Endonucleases Modify Homing Endonucleases to Recognize new target sites. Use Zinc Finger Nucleases

  8. Zinc Finger Nucleases as Potential Reagents to Create Double-Strand Breaks in Normal Genes FokI nuclease domain (Fn) FokI nuclease domain (Fn) Initially developed by labs of Srinivasan Chandrasegaran (Johns Hopkins) and Dana Carroll (Univ. Utah)

  9. ZFN Full Site/Sce Site GFP* CD8 CMV/CBA IRES WRE Sce or ZFN Expression Plasmid tGFP GFP Donor CD8 FP G CMV/CBA IRES WRE tGFP GFP CD8 CMV/CBA IRES WRE

  10. Model Zinc Finger Nucleases Stimulate Gene Targeting QQR Site 6 Sce Site Zif Site 7000 4150 4785 6000 5000 4000 3000 2000 1000 53 14 0 Sce QQRL0 Zif QQRL0/Zif Porteus and Baltimore (2003)

  11. Continuous Expression of ZFNs causes Cytotoxicity Time Course of Gene Targeting Using Sce Relative Rate of Gene Targeting Time Course of Gene Targeting Using Zinc Finger Nucleases

  12. Can we design a pair of zinc finger nucleases to stimulate gene targeting in a real gene in human somatic cells?

  13. FokI nuclease domain (Fn) FokI nuclease domain (Fn) Zinc Fingers Bind Triplets

  14. How to assemble a new zinc finger protein? • By altering the contact residues one can alter the target triplet. • By mixing different fingers one can assemble a zinc finger protein with new target site specificity. • Theoretically if one had zinc fingers for all 64 possible triplets one could assemble a zinc finger protein to recognize any sequence. • Zinc fingers have been published that recognize all 16 GNN,ANN, CNN triplets. • But, the GNN fingers are best.

  15. Can we assemble a pair of zinc finger nucleases to stimulate gene targeting? Full Site Consensus Sequence 5’ nnCnnCnnCnnnnnnGnnGnnGnn 3’ (GNNGNNGNN inverted repeat separated by 6 bp) Such a sequence occurs in both GFP (twice) and CD8 Lucky, eh?

  16. Empiric Design of Zinc Finger Nucleases (assembly approach) From Liu et al. (2002)

  17. Gene Targeting with Zinc Finger Nucleases to GFP Fn GFPZF2 5’ acC atC ttC ttc aagGac Gac Ggcaac stop-Sce site tac 3’tgG taG aaGaag ttc Cgc Ctg Ccg ttc GFPZF1 Fn Finger1Finger2Finger3 GFPZFN-1 QSSHLTR TRGNLVR QSGNLAR (ggt) (gat) (gaa) GFPZFN-2 DRSHLTR DRSNLTR DRSNLTR (ggc) (gac) (gac)

  18. GFP ZFN Site Sce Site GFP* CD8 CMV/CBA IRES WRE Sce or ZFN Expression Plasmid tGFP GFP Donor CD8 FP G CMV/CBA IRES WRE tGFP GFP CD8 CMV/CBA IRES WRE

  19. Gene Targeting with Zinc Finger Nucleases to GFP GFP Positive Cells per Million Transfected Cells Sce GFPZF1-Fn GFPZF2-Fn

  20. CD8 Knockout Using Zinc Finger Nucleases Fn CD8ZF2 bp 441 5’acc ggCgcCcaC catcgc GtcGcaGcc ctg 3’ bp 471 tgg ccGcgGgtG gtagcg CagCgtCgg gac CD8ZF1 Fn

  21. Knockout of CD8 transgene Using CD8 Zinc Finger Nucleases 85% CD8 Positive Cell Line CMV/CBA GFP* IRES CD8 CD8 Knockout Plasmid 10/10 clones CD8+ 16% CD8 Negative CD8 Knockout Plasmid + CD8 ZFNs 0/12 clones CD8+ 80% CD8 Negative

  22. Demonstrates in Principle • Can make somatic cell knock-outs with ZFNs • Can do targeted transgenesis with ZFNs. • i.e. Substitute gene of interest for selectable marker (or both. . .) and insert into pre-selected, “safe” and “permissive” genomic location.

  23. How far from the site of the break can you get targeting?

  24. Co-conversion of Markers by Gene Targeting CMV-Sce 37GFP-IRES-Puro-IRES-CD8 37GFP-IRES-Puro-IRES-CD8 CMV/CBA-GFP*-IRES-CD8a-PGK-Neo Stop-Sc e Site Stop-Sce Site

  25. Frequency of Co-Conversion using DSB Mediated Gene Targeting CMV/CBA-GFP-IRES-Puro-IRES-CD8a-PGK-Neo Day 3 Day17 Fold Change (no puro) (puro selection) % GFP + Cells 0.041% 58% 1400 Total GFP + Cells 1200 66 (-18) % GFP + Cells 0.013% 17% 1200 Total GFP + Cells 405 2 (-200)

  26. Demonstrates: • Can get targeting at a distance (up to 400 bp) from site of DSB (at a price). • Can do co-conversion • i.e. Correct mutation at one location and insert gene that confers selective advantage nearby.

  27. Can we design zinc finger nucleases to stimulate gene targeting in a gene that causes human disease? Collaboration with Sangamo Biosciences (Richmond, CA)

  28. Human Interleukin-2 Receptor Common Gamma Chain Deficiency (IL2RG) • Part of Receptor Complex for IL-2, IL-4, IL-7, IL-9, IL-15, IL-21. . . • On X-chromosome • Mutations in which are the most common cause of SCID (severe combined immunodeficiency) • -25% of mutations lie in Exon 5. • 4. Selective Advantage for corrected cells. 5. Treatment -Bone Marrow Transplantation : Allogeneic (sibling) : Haploidentical (parent) -Gene Therapy : Alain Fischer trial in France : Ooops, leukemia.

  29. ZFN Gene Correctionat the IL2RG gene IL2RG ZFN-R 5’CTACACGTTTCGTGTTCGGAGCCGCTTTAACCCACTCTGTGGAAGTGCTC 3’ 3’GATGTGCAAAGCACAAGCCTCGGCGAAATTGGGTGAGACACCTTCACGAG 5’ IL2RG ZFN-L GFP Gene Targeting Reporter for IL2RG ZFNs 5’ GFP 3’ GFP IL2RG site Sce site Target site of GFP ZFNs

  30. Stimulation of Gene Targeting Using ZFNs for the IL2RG Gene 2500 1968 2000 GFP Positive Cells per Million Transfected Cells 1500 715 1000 500 0 GFP ZFNs IL2RG ZFN-L IL2RG ZFN-R 5-8L0/5-9L0 M16/M17

  31. Optimization of IL2RG ZFN-L 5000 3892 4500 4000 2897 3500 GFP Positive Cells per Million Transfected Cells 3000 2500 1276 2000 1500 1000 500 0 IL2RG ZFN-R IL2RG ZFN-R IL2RG ZFN-R IL2RG ZFN-L IL2RG ZFN-L(D) IL2RG ZFN-L(G)

  32. Optimization of cgc ZFN-R 5000 4420 4500 4000 3500 GFP Positive Cells per Million Transfected Cells 2943 2940 3000 2689 2656 2500 1937 2000 1500 1000 500 0 cgc ZFN-LG cgc ZFN-LG cgc ZFN-LG cgc ZFN-LG cgc ZFN-LG cgc ZFN-LG cgc ZFN-R cgc ZFN-R cgc ZFN-R cgc ZFN-R cgc ZFN-R cgc ZFN-R (A) (B) (C) (D) (E) 1 2 3 4 5 6

  33. 4-Finger Zinc Finger Nucleases Seem to Have Less Cytotoxicity GFP Positive Cells per Million Transfected Cells Day3 Day5 Day7

  34. Experimental Design to Detect Targeting at Endogenous IL2RG Locus Transfect K562 cells with IL2RG ZFNs with repair substrate that contains BsrBI polymorphism. Isolate individual clones (no selection). Expand individual clones (no selection). Harvest genomic DNA from individual clones. Analyze genomic DNA for BsrBI polymorphism.

  35. bB BB bB bB bB bB BB BB bB BB bB BB bB bB Bi-Allelic Targeting in Human Somatic Cells (K562) Total clones: 76 Corrected: 14 (18%) bB: 9 (11.5%) BB: 5 (6.5%)

  36. Design ZFNs to other target genes. • Develop efficient method to make specific ZFNs that recognize a broad range of sequences. • Refine ZFNs for use in primary cells, including stem cells. • Assess possible induction of genomic rearrangements by ZFNs. • Eliminate • Use as a tool to study sequence specific DSBs in genetic instability. • Develop as a therapeutic tool. Future Directions

  37. Potential Applications to Aging Research Audience will be more clever than I. Use as an experimental tool to study genetics of aging in mammalian cells. Create allele specific gene variants in stem cells that are associated with slower “aging.”

  38. Thank You UT Southwestern Patrick Connelly Ruth Ebangit Brian Ellis Shondra Pruett Kimberly Wilson Funding Burroughs-Wellcome Fund Career Development Award NIH Career Development Award UT Southwestern Medical Center Sangamo Biosciences Fyodor Urnov Michael Holmes Jeff Miller Philip Gregory Casey Case

More Related