1 / 50

MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger

MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger Lecture 13 HW1+2 Non Coding Transcripts hg18.chr3:3,990,437-4,003,094 Zoom out of hg18.chr3:3,990,437-4,003,094 Mouse inversion Mm9 Browser hg18.chr9:38,764,619-38,905,426

Audrey
Download Presentation

MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. MW  11:00-12:15 in Beckman B302 Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger http://cs273a.stanford.edu [Bejerano Aut08/09]

  2. Lecture 13 • HW1+2 • Non Coding Transcripts http://cs273a.stanford.edu [Bejerano Aut08/09]

  3. hg18.chr3:3,990,437-4,003,094

  4. Zoom out of hg18.chr3:3,990,437-4,003,094 Mouse inversion Mm9 Browser

  5. hg18.chr9:38,764,619-38,905,426

  6. Zoom out of hg18.chr9:38,764,619-38,905,426 Human Duplication

  7. Meet Your Genome contd. [Human Molecular Genetics, 3rd Edition] http://cs273a.stanford.edu [Bejerano Aut08/09]

  8. Most Non-Coding Elements are likely cis-regulatory “IRX1 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.” gene deserts regulatory jungles 9Mb http://cs273a.stanford.edu [Bejerano Aut08/09]

  9. Structural RNAs http://cs273a.stanford.edu [Bejerano Aut08/09]

  10. Central Dogma of Biology:

  11. RNA is an Active Player:

  12. What is ncRNA? • Non-coding RNA (ncRNA) is an RNA that functions without being translated to a protein. • Known roles for ncRNAs: • RNA catalyzes excision/ligation in introns. • RNA catalyzes the maturation of tRNA. • RNA catalyzes peptide bond formation. • RNA is a required subunit in telomerase. • RNA plays roles in immunity and development (RNAi). • RNA plays a role in dosage compensation. • RNA plays a role in carbon storage. • RNA is a major subunit in the SRP, which is important in protein trafficking. • RNA guides RNA modification.

  13. The modern world The RNA world DNA RNA RNA Proteins information flow Information carryer replication

  14. Predicting RNA Secondary and 3D Structure from Sequence: AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC UCAGGGGAAACUUUGAGAUG GCCUUGCAAAGGGUAUGGUA AUAAGCUGACGGACAUGGUC CUAACCACGCAGCCAAGUCC UAAGUCAACAGAUCUUCUGU UGAUAUGGAUGCAGUUCA Cate, et al. (Cech & Doudna). (1996) Science 273:1678. Waring & Davies. (1984) Gene 28: 277.

  15. http://cs273a.stanford.edu [Bejerano Aut08/09]

  16. http://cs273a.stanford.edu [Bejerano Aut08/09]

  17. MP MP MP ML ML ML G A A A – U G – C G – C RNA sequence analysis - SCFGs G G A A G A U C C < < < . . . > > >

  18. http://cs273a.stanford.edu [Bejerano Aut08/09]

  19. http://cs273a.stanford.edu [Bejerano Aut08/09]

  20. http://cs273a.stanford.edu [Bejerano Aut08/09]

  21. http://cs273a.stanford.edu [Bejerano Aut08/09]

  22. MicroRNA http://cs273a.stanford.edu [Bejerano Aut08/09]

  23. Genomic context 180 known miRNAs in human 130 intergenic 50 intronic 60 polycistronic 70 monocistronic

  24. AAAAAAA ncRNA gene contexts tRNA, snRNAs,SRP, RNase P ….. Xist miRNAs miRNAs, snoRNAs

  25. Example: tRNA Bafna

  26. http://cs273a.stanford.edu [Bejerano Aut08/09]

  27. Human Specific Rapid Evolution maximally changed m c h r m h r 100%id 100%id http://cs273a.stanford.edu [Bejerano Aut08/09]

  28. Human accelerated http://cs273a.stanford.edu [Bejerano Aut08/09]

  29. Nearest Neighbor Model for RNA Secondary Structure Free Energy at 37 OC: Mathews, Disney, Childs, Schroeder, Zuker, & Turner. 2004. PNAS 101: 7287. http://cs273a.stanford.edu [Bejerano Aut08/09]

  30. RNA structure: Basics • Key: RNA is single-stranded. Think of a string over 4 letters, AC,G, and U. • The complementary bases form pairs. • Base-pairing defines a secondary structure. The base-pairing is usually non-crossing. Bafna

  31. http://cs273a.stanford.edu [Bejerano Aut08/09]

  32. Unfortunately… • Random DNA (with high GC content) often folds into low-energy structures. • What other signals determine non-coding genes? Bafna

  33. http://cs273a.stanford.edu [Bejerano Aut08/09]

  34. RNA structure: pseudoknots • Sometimes, unpaired bases in loops form ‘crossing pairs’. These are pseudoknots. Bafna

  35. Other Non Coding Transcripts http://cs273a.stanford.edu [Bejerano Aut08/09]

  36. http://cs273a.stanford.edu [Bejerano Aut08/09]

  37. mRNA http://cs273a.stanford.edu [Bejerano Aut08/09]

  38. EST http://cs273a.stanford.edu [Bejerano Aut08/09]

  39. Microarrays http://cs273a.stanford.edu [Bejerano Aut08/09]

  40. Transcript Ends http://cs273a.stanford.edu [Bejerano Aut08/09]

  41. Transcript mapping Affy arrays CAGE, SAGE, diTAGS, etc. http://cs273a.stanford.edu [Bejerano Aut08/09]

  42. End Picture http://cs273a.stanford.edu [Bejerano Aut08/09]

  43. Transcripts, transcripts everywhere Human Genome Leaky tx? Functional? Transcribed (Tx) Tx from both strands http://cs273a.stanford.edu [Bejerano Aut08/09]

  44. http://cs273a.stanford.edu [Bejerano Aut08/09]

  45. http://cs273a.stanford.edu [Bejerano Aut08/09]

  46. http://cs273a.stanford.edu [Bejerano Aut08/09]

  47. http://cs273a.stanford.edu [Bejerano Aut08/09]

  48. X Dosage compensation X chromosome inactivation in mammals X Y X X

  49. Avner and Heard, Nat. Rev. Genetics 2001 2(1):59-67 Xist – X inactive-specific transcript

  50. Meet Your Genome the end? [Human Molecular Genetics, 3rd Edition] http://cs273a.stanford.edu [Bejerano Aut08/09]

More Related