1 / 53

sdAb as Therapeutic Agent

Full-length monoclonal antibodies have been highly successful as therapeutic agents against various immune diseases and cancers. However, the large size severely limits their applications. As an alternative, single domain antibodies (sdAbs) present great advantages as novel therapeutic agents, such as small size, high expression, improved robustness, and a large number of accessible epitopes. Creative Biolabs is committed to providing customized proposals and solutions to develop novel sdAb-based therapeutics for disease treatment.<br><br>https://www.creative-biolabs.com/sdab/sdab-as-therapeutic-age

Shaw2
Download Presentation

sdAb as Therapeutic Agent

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. CREATIVESINGLEDOMAIN ANTIBODYDISCOVERY BIOLABSANDENGINEERING www.creative-biolabs.com/sdab

  2. sdAb Discovery sdAb Development • DeNovosdAb Sequencing • sdAbAffinityMaturation • sdAbHumanization • BispecificsdAb Engineering • sdAbConjugation • sdAbStability Improvement • AntibodyCamelization • Immune sdAb Library ConstructionandScreening • PremadesdAbLibrary Screening • IntrabodyDiscovery • Anti-MembraneProteinsdAb Discovery • Anti-IdiotypesdAbDiscovery • Anti-BBB sdAbDiscovery • Anti-AlbuminssdAbDiscovery • CustomsdAbProduction Over10YearsExtensive ExperienceInAntibody Discovery& Development EXCELSIOR FLEXIBLEOPEN High-QualityService ProviderForResearchers AllOverTheWorld! CONTENT

  3. 01 ABOUT CREATIVEBIOLABS FIRSTPART CREATIVEBIOLABS

  4. INTRODUCTION ExpertsinCustomAntibodyService • MonoclonalAntibodyGenerationInAllSpecies • AffinityMaturation • BispecificAntibodyEngineering • Native™AntibodyDiscovery • DenovoAntibodySequencing • AntibodyHumanization • AntibodyMurinization,Caninization & Camelization • AntibodyDevelopmentAgainstMembrane Proteins • Human AntibodyProduction Using Transgenic Mice • Antibody-DrugConjugate • ChimericAntigen Receptor(CAR)Services • ImmunogenicityAssessment • StableCellLineConstruction

  5. INTRODUCTION SingleDomain Antibody alsoknownas domain antibody,VHH,VNARor sdAb,isakindofantibody fragmentsconsistingofasinglemonomeric variableantibodydomainandlackingthelight chain and CH domainoftheheavy chainin conventionalFabregion.

  6. INTRODUCTION ADVANTAGESOFsdAb Expressible in both eukaryotic and prokaryotic systems Smallestantibodyfragment with only~15kDa Outstanding penetrability which is able to cross the blood-brainbarrier 07 01 04 Excellent chaperone for the crystallizationof challengingtargets Recognize novel/hidden epitopes that conventional antibodiescannot Short plasmahalf-life and better clearance as diagnostic tool 08 02 05 Great potentialin downstreamengineering (e.g. fusion protein and humanization) High stabilityto functionand exist withinextremeconditions andintracellularenvironment Improved bioavailability for therapeutic applications 09 03 06

  7. 02 SINGLE DOMAIN ANTIBODYDISCOVERY SECONDPART CREATIVEBIOLABS

  8. DISCOVERY ImmunePhageDisplayLibrary Construction andScreening Anti-MembraneProtein sdAbDiscovery 01 05 PremadesdAbLibrary Screening Anti-IdiotypesdAb Discovery 02 06 03IntrabodyDiscovery 07 Anti-BBBsdAbDiscovery Anti-AlbuminssdAb Discovery Custom sdAbProduction 08 04

  9. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY Phage display is a long-lasting laboratory platform for the large-scale study of molecules interaction, such as protein- protein, protein-peptide and protein-DNA interactions andmoleculeselection. Relying on engineering bacteriophages to display interested molecules on their surface, phage display can result in a linkage between genotype and phenotype.

  10. 2.1 ImmunePhageDisplayLibraryTechnology DISCOVERY SingleDomain Antibody 01 Specific Antigens (e.g. Recombinant Proteins, Membrane Proteins, Peptides,andHaptens) 01 02 Fab scFv 03 Display Capabilities Selection Targets InorganicChemical Compounds 02 Peptide 04 03 WholeCells Scaffold(e.g.DARPins, andMonobody) 05 06 cDNA

  11. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY RaisingsdAbAgainstChallengingTargets We raisedexcellent phospho-specific single domain antibodiesagainsttwophosphorylationsites. Weraisedhigh-affinitymonoclonalsingle domain antibodies againstnucleotides. Dr.Erich Koller F.Hoffmann-LaRocheLtd. PharmaceuticalSciences, pRED Building69, Rm155, CH-4070Basel,Switzerland Tel:+4161 68721 41 Email:erich.koller@roche.com Prof.StefanSchulz JenaUniversityHospital,Instituteof Pharmakology andToxikology DrackendorferStr.1,D-07747Jena Email:stefan.schulz@mti.uni-jena.de

  12. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY StandardProtocol • AnimalImmunization • RNAIsolation • RT-PCR • Amplification of VHH ExpressionCassette • Ligation and Transformation • PrepareM13KO7HelperPhage • Prepare Antibody Library Phages • AntibodyLibraryBiopanning • Solid-Phase • Solution-SortingwithPlate • Solution-SortingwithBeads • PolyclonalPhageELISA • MonoclonalPhageELISA • DNASequencing • SolublesdAb ELISA • BioinformaticsAnalysis • RecombinantsdAbProduction

  13. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY Interms of theadvancedphagedisplay technology,CreativeBiolabshasunparalleledcapabilitiesfor the construction of VHH or VNARbased single domain antibody libraries through immunized camel, llama, alpaca orshark. Our scientists have vast experience constructing and screening immunized phage display sdAb libraries. We usually obtain immunized sdAb libraries with an overwhelming capacity of 10-100 million that can derivate antibodies with excellent affinity/specificity.

  14. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY Wecommonlycooperate withaUSDAregisteredresearch facility that hasNIH/OLAW assurances.Thisis an approved bloodcollection facility underEC1069/2009forexport of animalbloodproductsto EU countries.The NIH and USDA assurancesas well as EC1069/2009 assuranceareavailable uponrequest. THE PARTNER ANIMALFACILITY

  15. DISCOVERY 2.1 ImmunesdAbLibraryConstructionandScreening Standard Immunization Procedure (3-weekinterval) Weare opentoperform customimmunization procedure to meet your specific requirement High-quality RNA will be extracted at the same day after theproductionbleedtoensure the best starting material for libraryconstruction.

  16. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY PhageDisplayAntibodyLibraryConstruction 1stPCR 1 2ndPCR Degenerate primers have been used to amplify the VHH fragmentsandgeneratedVHHlibrariesforthe corresponding species(llama,alpacaorcamel). 1 2 3 4 M M Creative Biolabs has designed and validated degenerate primersforamplifyingVHH-Fcgene andVHHgene.Wehave used these primers to generate VHH libraries that can be expressedonthesurfaceofbacteriophagewithourpCDisplay vector.

  17. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY • LibraryQC(SampleReport) • According tothe example,18 randomclonesfrom the end library was subjected to QC colony PCR. 14 out of 18 clonescarrysense VHHgenes. • Randomclones fromthe end librarywassubjected • toDNAsequencing. M123456789CK Lane1-18: PCRproductsfor randomclonesfromtheend library. Lane CK: PCR products with the empty phagemid as the template, negativecontrol. M101112 131415161718CK Lane M: DL2000 DNA Marker (2000,1000,750,500,250,100 bp)

  18. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY LibraryQC(SampleReport) • TheVHHsequenceswere alignedtogether. • All sequences are unique, indicating good diversity of the end library.

  19. DISCOVERY 2.1 ImmunesdAbLibraryConstructionandScreening LibraryScreeningStrategies Option1.Solid-PhaseScreening Option2.Solution-Sorting Screening(plateorbeads)

  20. DISCOVERY 2.1 ImmunesdAbLibraryConstructionandScreening ExampleofScreeningReport

  21. 2.1 ImmunesdAbLibraryConstructionandScreening DISCOVERY BinderSelectionStrategies • Phage amplification of binder phage clones obtained from enriched phage library. Verify the specific binders, including: • Phageamplification • PhageELISA against thetarget • PhageDNA extraction • PhageDNAsequencing

  22. DISCOVERY 2.1 ImmunesdAbLibraryConstructionandScreening ExampleofPhageELISA

  23. DISCOVERY Magic™TherapeuticAntibodyDiscoveryPlatform As a pioneer and undisputed global leader in antibody discovery and manufacture,CreativeBiolabshas established the exclusiveMagic™TherapeuticAntibody Discovery Platform (MTADP) to obtain all possible promising antibodies inphage display library. For diagnosticandtherapeuticantibodyproduction, the onlywaytogetgoodantibodieswithallrequired properties istohavealargenumberofantibodycandidates first. It is very common that a suitable antibody (pair) can only be discovered from 100-300 regular binders raised using different methods in different animals,thushave very diverseproperties andsequences.

  24. DISCOVERY Magic™TherapeuticAntibodyDiscoveryPlatform Identification of allthepotential candidates inantibodylibraryisacritical step in single domainantibodydevelopment. Anenrichedlibraryderivedfrom phage display couldconsistsofmillionsof cloneswhichis notpossibleto be coveredbythe conventional validationmethods. As a solution to these problems, our unique Magic™ platform is all about time to results. The more antibodies you can get from the screening, the more and morereliable-functionalantibodiesyoucan sendfordownstreamevaluation. Throughthispowerful platform, a large numberofantibodycandidatesspecific forthetargetcan beisolated atonetime.Once antibodiestargeting different epitopes with different affinity and specificity are obtained, we are able to fast andprecisely identifythe clones withthe highestaffinity andspecificity.

  25. DISCOVERY Magic™TherapeuticAntibodyDiscoveryPlatform HighSuccessRates We have aproven recordof successfully selecting the antibodies with high affinity andspecificityusingMagic™ Platform. RapidTurnAround Receive resultsassoonas 4-6 weeks. Cost-effective Our high-qualitydata andhigh success rates ensures the identification of all possible candidates in the library, avoidscostly repeatof conventional selection, which saves your money and timein ultimate. 01 02 03

  26. OverTenTimesNewBindersDiscovered FromMagic™Platform(SampleReport) DISCOVERY • Project Description • A phage display VHH antibody library was constructed with adiversityof ~108. • After the biopanning and ELISA validation, 5 VHH was discovered fromthe enrichedlibrary. • In ordertocoverallthediversityof theenrichedsub-library, Magic™PlatformwasperformedtoinvestigatetheVHH pool.

  27. OverTenTimesNewBindersDiscovered FromMagic™Platform(SampleReport) DISCOVERY Mostsequences centeredaround 450bp Sequencepattern(* standfor targetsequence): GTTATTACTCGCAGCAAGCGGCGCGCATGCC*****GCTAGCGAACAAAAACTCATCTCAGAAGAGGATCT

  28. DISCOVERY OverTenTimesNewBindersDiscoveredFromMagic™Platform(SampleReport) VHH Protein Sequences(Raw) Compared withthefive VHH bindersrediscoveredusing the conventional method

  29. OverTenTimesNewBinders DiscoveredFromMagic™Platform (SampleReport) DISCOVERY • VHH Protein Sequences(Clustered) • 61VHHbinders have been identified. • These new sequences have been separated into 22 groups according to the characteristics of CDR domains and labeledwith differentcolors.

  30. OverTenTimesNewBindersDiscovered FromMagic™Platform(SampleReport) DISCOVERY ResultSummary • From the conventional strategy, 5 different sequences were discovered, and theyarerediscoveredbytheMagic™Platform.Themostfrequent sequencesfoundintheconventionalmethodarecorrespondingto the most abundant cluster in theMagic™result. • Throughthe Magic™Platform,wefound56NEWVHH binders.Thesenew discoveredsequences havebeenclustered into22groupsaccordingtothe characteristicsof CDRdomains.

  31. 2.2 PremadePhageDisplayVHHLibraryScreening DISCOVERY CREATIVEBIOLABS Quality /Science/Dedication

  32. 2.2 PremadePhageDisplayVHHLibraryScreening DISCOVERY • CreativeBiolabshasbuiltupa HuSdL™Human SingleDomainAntibodyLibrarythatallows rapiddiscovery oflarge numbersof high-potency camelizedhumansingledomain antibodiesagainstany therapeutictargets. • Mostrobustandstraightforward • Low immunogenicity: our library produces camelized human antibodiesthat have ahumanorigin,thusthe lowest immunogenic potential in humans, especially for long-term and multiple-dose administration. • Adequatedevelopability:thelibrary waspreselectedbasedonthe thermostability and expressibility (in E. coli) of the displayed antibodies.Inparticular, inthelibrary, theantibodyrepertoirewas heat-treatedtoremoveclones thatcouldnot withstandheat- induced aggregation.

  33. 2.2 PremadePhageDisplayVHHLibraryScreening DISCOVERY Our premade single domain antibody library was constructed based on either camelized human VH3 in FR2 or naïve camelid VHHrepertoire. AcceptedTargets: Screening Strategies: • WholeCells/Tissues • Peptides/Haptens • RecombinantProteins • MembraneProteins • OtherinvivoTargets • Solid-PhaseScreening • Solution-SortingScreening • Cell-basedScreening • InvivoScreening • ExvivoScreening • More… CreativeBiolabscanalsolicense thesepremadesdAblibraries toourclientswho prefer toscreenthenovelsdAbsthemselves!

  34. DISCOVERY 2.3 IntrabodyDiscovery • Creative Biolabs has built up A novel intrabody discovery platform to screen and validate novel single domain antibodies that can bind to intracellular targets specifically withinvariouscellularcompartments. • Two-HybridDetectionSystem • AdvancedPhageDisplayPlatform • Invivoantigenexpression. • Asolutionto identifybinderstoproteinsordomains, • whichareunstableexvivo,difficult topurify,orexpensive to purchase. • Canvalidate specificantibody ineitherhigh- or low- throughout manner Platform TypicalFeatures

  35. 2.4 Anti-MembraneProteinsdAbDiscovery DISCOVERY Creative Biolabs has developed a robust and highly effective strategy forgenerating sdAbstargeting membrane proteins using DNA immunization, whole cell immunization and many otherstrategies. Followed by high-throughput screening on cell lines expressingtargetmembrane proteinsin native conformation andsubsequentanalysisby FACS,wehave successfully selectedagreat many potentsingledomain antibodiesat nanomolar or sub-nanomolar level, with desired functionalities.

  36. 2.4 Anti-MembraneProteinsdAbDiscoveryviaDNAImmunization DISCOVERY Designthebest fitimmunizationprocedure High-qualityImmune LibraryConstruction High-throughputscreeningoncelllines Improved immunizationstrategies Optimizedboostschedule Wholecellimmunization Electroporation Otheruniquemethods SpecificBindersValidation

  37. 2.5 Anti-IdiotypesdAbDiscovery DISCOVERY • Creative Biolabs offers anti-idiotypic sdAb production service through immunizingcamel/llama/alpaca/shark with targetantibodiesintheforms ofwholeIgG,scFv,Fab,Fab’or F(ab’)2. • Applications • Antibodydrugpharmacokinetic/pharmacodynamics(PK/PD)studies • Antibodydrugimmunogenicity(immune response,IR) studies • Preclinicalresearchof therapeuticantibodies • Anti-drugantibodies(ADA)forclinicaldevelopment • Controls in ligand bindingneutralizingassays • Controls in antibody blockingassays

  38. 2.6 Anti-BBBsdAbDiscovery DISCOVERY Creative Biolabs offers blood-brain barrier specific antibodies with implications for the development of biologics-based treatment of braindisorders. Anti-BBBsdAbcanbeusedas vectorstotargetdrugs ortherapeutic peptides intothe brain. Our technologyalso aimstotarget endogenoustransportsystems, including carrier-mediated transporterssuchasglucose andamino acid carriers, receptor-mediated transcytosisfor insulin,transferrin or low-density lipoproteins (LRP1) and the active efflux transporters such as p-glycoprotein.

  39. 2.7 Anti-AlbuminssdAbDiscovery DISCOVERY Function • Typical Workflow • Animalimmunization (llama/alpaca/camel/shark) • Immunelibraryconstruction/Premadelibrary preparation • Libraryscreeningandvalidation • Anti-albumin sdAbproduction/further development Fusion with an anti-albumin sdAb is a potential optiontoextend the serumhalf-lifeof therapeutic agents. Anti-albumin sdAb will recognize the albumin after properly administration and allow the fused biopharmaceutical agent to be carried around the body, and to take on similar PK parameters with the albuminas well.

  40. DISCOVERY 2.8 CustomsdAbProduction Weoffercustomservicetoproducecustom singledomainantibodies. Wehave a Non-Exclusive Licensefrom the following partythatallows us to produce single domain antibodies from camelid (llama, camel, and alpaca). We will pay a royalty to this licensor while our customers havefullrighttoowntheresultingsingledomainantibodies.With this license, we can produce single domain antibodies using any method,notlimited tophagedisplay antibodylibraryconstruction and screening,whichis also patent-free. Tech TransferDepartment VIBvzw Rijvisschestraat120 9052Zwijnaarde Belgium Website:www.vib.be

  41. 03 SINGLE DOMAIN ANTIBODYDEVELOPMENT THIRDPART CREATIVEBIOLABS

  42. DEVELOPMENT DeNovosdAb Sequencing BispecificsdAb Engineering Antibody Camelization 01 04 07 sdAbAffinity Maturation sdAbConjugation 02 05 sdAbStability Improvement sdAb Humanization 06 03

  43. DEVELOPMENT • DeNovosdAbSequencing • ThroughtheproprietaryDatabaseAssisted ShotgunSequencing(DASS) technology,soluble andfunctionalsingle domainantibodycan bede novo sequenced by subunit with 100% coverage and dozens of successful cases proving 100%accuracy. • Specifications • SequencingoftheVand JandC segmentsbyDASS • DenovosequencingoftheCDR3region • Sequencingofisobaricaminoacids • W can bedistinguishedfromGE,ADand SV • Rcan bedistinguishedfrom GV • Qcan be distinguishedfromK • Ncan bedistinguishedfrom GG • Qcan bedistinguishedfrom GA • Leucine willbe predictedfromthegermlinesequencesandthecutting frequencyofchymotrypsin.

  44. DEVELOPMENT 3.2 sdAbAffinityMaturation CreativeBiolabs hasdeveloped aproprietaryDNAmutagenesistechnique thatisabletocreateahugenumber(e.g.1010) variantsoftheparental antibodywithdefinedpositionsmutated. Incombinationwithourfirstclassphagedisplayantibody library constructionandscreeningtechnologies,10-100foldincreaseinaffinityfor parentalsingledomainantibodies oflownMaffinityisfrequently achieved. Validatealargenumber,e.g.80,affinity-maturedindividualmutants using phage ELISA andantibodyELISA. A phage display mutant library at a size of 1010is created foreach parentalsdAb. 02 01 Frequentlyuse parentalsdAborantigento washaway weakmutants. Affinity (e.g. KD) determination on top 5 affinity-matured sdAb mutants. 03 04 High-throughputbiopanningto isolate raremutantswith affinity-increased for 10or morefold. 06 05 Get sdAbsofanaffinity of0.1nMoverbetter.

  45. DEVELOPMENT 3.3 sdAbHumanization&HumansdAbDiscovery Creative Biolabs has extensive experience in generating human single domain antibodies and humanizing singledomain antibodies. Threeapproachestodevelop human/humanizedsdAb • Screening of the premade synthetichumansdAb library • Immunizing transgenic mice that harbor human single domain antibody generepertoires • sdAbhumanization • Employs soluble, stable, well expressed universal humanized single domain antibody scaffolds • CDRgrafting • Back-mutation

  46. DEVELOPMENT 3.4 BispecificsdAbEngineering Bispecificantibodies(bsAbs),whichare capableof simultaneous binding to two different targets, are consideredthe mostpromisingsolutionto increase therapeutic activity by retargeting a large varietyof payloads to cancercells. Strategy: Link two single domain antibodiesviaapeptidiclinker,thereby creating a tandem single domain antibody. Successfully example: A few bispecific single domain antibodies with neutralization activity obtained using a specially designed linker based on the hinge region ofthellamaIgG2aisotype

  47. DEVELOPMENT 3.5 sdAbConjugation Introduction Bioconjugation isa chemicalstrategy toform a stable covalent link between two molecules. Conjugated sdAbshavebeenfoundsignificantapplicationsfor enhanced stability, sensitive and functionalities in diagnostics andtherapeutics. • Benefits • Performedbyprofessionalsinthisfield • Considerable conjugationratio and scale • Quickturnaroundtimeandeconomicalexpenditure • High-qualityresults Applications • Biologicalinteractiondiscovery • Diagnosticapplications • Extend the half-life of single domain antibody

  48. DEVELOPMENT 3.5 sdAbConjugation sdAb BiotinylationService 01 sdAb-Enzyme ConjugationService 02 03 sdAb-FluorophoreConjugationService sdAb-Gold NanoparticleLabelingService 04 sdAb PEGylationService 05 sdAb-PolystyreneBeadsLabelingService 06 07 sdAb-Quantum DotsConjugationService

  49. DEVELOPMENT 3.6 sdAbStabilityImprovement • InvitrosdAb stability • Physicalstability(thermodynamic • stability) • Chemical stability (proteolytic stability) • Approaches • Two amino acid substitutions within the framework to form an additional intra-domaindisulfidebond. • CDRisgraftedontothestable • framework.

  50. DEVELOPMENT 3.7 AntibodyCamelization • Creative Biolabs provides service of in silico design of camlized human antibodies. • We select the single domain antibody framework with the best homology to human VH backbone, perform CDR grafting in silico, and then run computer based antibody modeling todo backmutations. • Combined with construction and screening of a custom single domain antibody library, camelized (human) antibody sequences of thebestaffinityare generated. • HuSdL®HumanSingleDomainAntibodyLibrary Camelizedhumanantibodies • Thesingleserviceproviderintheworld!

More Related