Resistance Mechanisms of HIV-1 Reverse Transcriptase Mutants K65R, M184V, and K65R+M184V to NRTIs

1. Resistance Mechanisms of HIV-1 Reverse Transcriptase Mutants K65R, M184V, and K65R+M184Vto NRTIs JK Ly, NA Margot, HL MacArthur, M Hung, MD Miller, KL White Gilead Sciences Inc., Foster City, CA

2. NtRTI and NRTI Resistance Mutation Background • 8 currently approved NtRTI and NRTIs: • TDF, ddI, ABC, FTC, 3TC, ddC, AZT, d4T • K65R: • Selected by TDF, ABC, ddI, and occasionally d4T • Observed in 2-5% of antiretroviral-experienced patients • M184V: • Selected by FTC, 3TC, ABC • Observed in >50% of antiretroviral-experienced patients • K65R+M184V: • Selected by TDF/FTC, ABC, other drug combinations • 50% of patients with K65R also have M184V

3. Study Objective • To measure the biochemical resistance mechanisms for K65R, M184V, and K65R+M184V mutant RT and determine their contributions to resistance. N(t)RTI Susceptibility = + Binding or Incorporation Excision Steady State Ki / Km Excision Rate

4. 240 K65Rb M184Vb K65R+M184Vb 12 10 8 Fold Increase (EC50) 6 4 2 TFV ddI 3TC ABC d4T AZT Susceptibility of Mutant Viruses to N(t)RTIsa a. PhenoSense Assay (Monogram Biosciences). b. Mean fold change for K65R alone ( n > 110); M184V/I alone (n > 1930); K65R+M184V/I (n = 70). — Yellow bars represent lower clinical cut-offs.

5. Altered Binding or Incorporation of N(t)RTIs a. Mean fold increase were determined from 3 or more independent experiments.

6. Altered Binding or Incorporation of N(t)RTIs a. Mean fold increase were determined from 3 or more independent experiments.

7. dNTP(Next nt) Excision Assay Methodology • Rescue of polymerization assay: • Primer-NRTI :: Template • HIV-1 RT (excess) • Physiological [ATP] and [dNTPs] • Time course, RT inactivation • dNTP + Klenow elongation ATP ATP-Ŧ Ŧ *-5’CTACTAGTTTTCTCCATCTAGACGATACCAGA 3’GATGATCAAAAGAGGTAGATCTGCTATGGTCTAACTTCTGGAGTCGTGAG HIV-1 RT • Factors affecting excision: • RT mutations • N(t)RTI translocation • Next nucleotide inhibition • Primer/template sequence context

8. WT K65R M184V K65R+M184V Altered Excision of N(t)RTIs (ATP-mediated) TFV AZT 14 14 12 12 10 10 Primer Rescued (%) 8 8 Primer Rescued (%) 6 6 4 4 2 2 0.1 1 10 100 1000 0.1 1 10 100 1000 dATP (mM) dATP (mM) • K65R and K65R+M184V mutants showed significantly reduced removal of TFV and AZT mediated by ATP. • For all other NRTIs tested, ATP-mediated excision was minimal by WT and mutants.

9. WT K65R M184V K65R+M184V Altered Excision of N(t)RTIs (PPi-mediated) TFV AZT 100 40 80 30 60 Primer Rescued (%) Primer Rescued (%) 20 40 10 20 1 10 100 1 10 100 dATP (mM) dATP (mM) • K65R and K65R+M184V mutants showed reduced removal of TFV and AZT by pyrophosphate. • M184V showed reduced excision of AZT.

10. Conclusions • In cells, both mechanisms of resistance—binding or incorporation (discrimination) and excision—may contribute to altered drug susceptibility • K65R shows increased drug discrimination (increased Ki/Km) for all N(t)RTIs • Counteracted by decreased excision for most N(t)RTIs, resulting in full susceptibility to AZT • M184V substrate discrimination correlates with N(t)RTI susceptibility • For AZT, decreased excision may also contribute to sensitization • K65R+M184V results in additive resistance for ddI and ABC at the level of discrimination, but increased sensitivity relative to K65R for TDF, d4T and AZT • Sensitization to AZT may be due to decreased excision • Sensitization to d4T and TDF is likely at the level of substrate discrimination

11. Acknowledgements Clinical Virology, Foster City, CA Kirsten White Nicolas Margot Damian McColl Rebecca Ledford Michael Miller Clinical Virology, Durham, NC Joy Feng Jenny Svarovskaia Josh Waters Katyna Borroto-Esoda Biology Holly MacArthur Magdeleine Hung Ruth Wang Martin McDermott Manuel Tsiang Computational Chemistry James Chen S. Swaminathan