1 / 22

Centre for Research on Introduced Marine Pests

Molecular detection techniques for monitoring three key pest species in ballast water samples from a southeastern port of Australia Jawahar Patil, Bruce Deagle, Rasanthi Gunasekera, Nic Bax and Chad Hewitt. Centre for Research on Introduced Marine Pests. The Problem.

airell
Download Presentation

Centre for Research on Introduced Marine Pests

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular detection techniques for monitoring three key pest speciesin ballast water samples from a southeastern port of AustraliaJawahar Patil, Bruce Deagle, Rasanthi Gunasekera, Nic Bax and Chad Hewitt Centre for Research on Introduced Marine Pests

  2. The Problem Ballast tanks = Mobile Aquaria • - Globally, ships transfer over 12 billion • tonnes of ballast water per year • Vessels travelling between ports will • potentially transfer organisms to • uninfected areas • -Pose Environmental, Economical and • Human health consequences

  3. Context ABWMAC-PEST list-1994 SpeciesCommon name Alexandrium catenella, Toxic Dinoflagellate Alexandrium minutum, Toxic Dinoflagellate Alexandrium tamarense, Toxic Dinoflagellate Gymnodinium catenatum, Toxic Dinoflagellate Asterias amurensis, North Pacific seastar Carcinus maenas, European shore crab Corbula gibba, European shore clam Crassostrea gigas, Pacific oyster Musculista senhousia, Asian mussel Sabella spallanzanii, European fanworm Undaria pinnatifida, Japanese seaweed Vibrio cholerae, Mnemiopsis leidyi and Comb jelley Potamocorbula amurensis Chinese clam MOST WANTED

  4. Context CRIMP developed a Ballast water Decision Support System(BDSS) Currently considered as a management tool by Australian Quarantine and Inspection Service (AQIS). However the risk associated with Type II error still remain to be quantified This project was conceived as part of the Port of Hastings National Demonstration Project- targeting 3 species

  5. Current Study -Need for physical/empirical verification - Usually done based on morphological features Problems: - time consuming - larvae with many stages difficult - high level of expertise required - some species ID is impossible - Can we use genetic markers to quickly ID larval and planktonic organisms?

  6. attgtattt Primer 2 ctacgg Primer 1 PCR Product Polymerase Chain Reaction (PCR) Allows amplification of a small region of DNA agaagggttctacgggtagagtattggtagtagtcatcgatgactacgaaaggtcgattgtatttgaacgtagttt • Specific • Sensitive

  7. Conserved Conserved Variable Conserved Variable Primary enrichment PCR Secondary specific PCR acctt Species specific PCR product atgcta gctag aaacct Nested PCR A.a:accttgaccagagctagtagtaggtaagtagtcagtcacgatcgcctacgactgacgactgactaaaacctccggcatgcta S1 :accttgacgagaactaatagtgggtaagtagtcagtcacgatcgcctacgactgacgactgactagcacctgcgccatgcta S2 :accttgacaagagctgctagtgggtaagtagtcagtcacgatcgcctacgactgacgactgactacgaatccccgcatgcta

  8. . ..... it has become very abundant Current distribution Asterias amurensis - Northern Pacific seastar, arrived in Tasmania in the 1980s

  9. PCR Performed on Asterias amurensis and native Australian seastar species using CASF1 and CASR1 primers. Aa: Asterias amurensis 1.Coscinasteriasmuricata 2.Uniophora granifera 3.Patiriella calcar 4.Tosia magnifica 5.T. Australis 6.Nectria ocellata 7.Echinaster arcystasus 8.Plectaster decanus 9.Petricia vernicina • Aa Aa 1 2 3 4 5 6 7 8 9 Internal Control Asterias specific Asterias specific PCR -mtCOI locus • Sequences aligned and 8 pairs of primers designed and tested

  10. - Adults and larvae - Proof is in the soup-What about mixed samples? - Tested ~100 individual seastars (15 species) and a diverse range of planktonic organisms -SPECIFIC

  11. Simulated ballast water testing - collected “blank” ballast water samples - spiked these samples with known # of larvae

  12. 3 1 2 6 5 4 filter plankton “spike” samples extract DNA PCR amplification separate PCR products results

  13. Aa # A. amurensis larva spiked (Bipinnaria) 200 mg of plankton as background Aa Results of a ballast water trial

  14. Non-Australian species of Asterias -A. rubens -A. forbesi - Both of these species give positive results with the PCR test “Genus- specific”

  15. Aa Ar Af Species discrimination- Gradient gel 1.A. amurensis TTCAAGATGATCAAATTTATAAAGTTATAGTAACTGCTCATGCTCTTGTAATGATATTTTTTATGGTGATGCCTATTATGATAGGA 2. A. amurensis ...................................................................................... 3. A. rubens .......C...................................C..C....................A.................. 4. A. rubens .......C...................................C..C....................A.................. 5. A. rubens .......C...................................C..C....................A.................. 6. A. forbesi ...................C..........................C..G.................A.................. 7. A. forbesi ...................C..........................C..G.................A..................

  16. Introduced in 1840s for commercial reasons • Has been a major environmental • concern. Formed “Feral”populations Crassostrea gigas

  17. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 CCSF3 and CCSR3 18S rDNA primers Primer pair CCSF3 and CCSR3; lane 2, C.gigas; lanes 3-4, Saccostrea glomerata;lanes 5-8, Ostrea angasi; lane 9-10, Mytilus edulis and lanes 11-19 18S rDNA internal control C.gigas -mtCOI locus • Sequences from several individuals and closely related species • were aligned and suitable primers designed and tested • Testing against other species in the genera • Sensitivity-Consistently detect-5 advanced larvae(20hr) • -10 early larvae (5 hr)

  18. Gymnodinium catenatum • Toxic bloom forming algae known • to cause PSP in humans • Thought Non-native to Australia, • with Unknown introduction history

  19. 1 2 3 4 5 6 7 8 9 10 11 12 13 Primer set-CGSLF2 and CGSLR3 G Catenatum- rDNA loci • SSU and LSU-tested 13 sets of primers 2. Alexandrium affine 3. A. catenella 4. A. margalefi 5. A. tamarense; 6-8. G. catenatum 9. Heterocaspa niei 10. Kryptoperidinium folaceum; 11. Scrippsiella sp 12. Wolonszynskia sp G microreticulatum G nolleri • Sensitivity-some physical hurdles and still needs optimization

  20. Conclusions • Developed genetic tests which detect Asterias, Crossostrea gigas • and Gymnodinium catenatum DNA. • We have been able to optimize conditions for detection in ballast water samples • Currently deployed for screening ballast water samples obtained as part of the Port of Hastings demonstration project. Screened Over 200 samples and hope to complete the whole set of over 500 samples

  21. Future work Liquid-Solid phase Nested PCR • Hope to deploy current probes for environmental studies • Develop semi-quantitative high-throughput screening as a tool for self certification of vessels

  22. Acknowledgements Dr Dr. Brad Evans, Dr.Bob Ward Ms Nicole Murphy, Dr. Sue Blackburn, Dr Chris Bolch and Ms Cathy Johnston-Provided one or more samples Ms Caroline Sutton-reared Asterias larvae Dr. Sharon Appleyard and Dr. Peter Grewe- ran sequencing gels. Dr Ximing Guo-Rutgers University-Oyster DNA Dr. Kimberly Reece-VIMS

More Related