Bioinformatics Introduction to molecular and cell biology

1. BioinformaticsIntroduction to molecular and cell biology Ulf Schmitz ulf.schmitz@informatik.uni-rostock.de Bioinformatics and Systems Biology Group www.sbi.informatik.uni-rostock.de Ulf Schmitz, Introduction to molecular and cell biology

2. Outline • Recommended Literature • What is Bioinformatics? • The Cell • Molecular Biology / Genomics • Genes • DNA • RNA • Proteins • Gene Expression • Signaling Pathways • Outlook next lecture Ulf Schmitz, Introduction to molecular and cell biology

3. Recommended Literature • Developing Bioinformatics Computer Skills; Cynthia Gibas & Per Jambeck; O’Reilly; ISBN: 1565926641 • New Biology for Engineers and Computer Scientists; Aydin Tözeren & Stephen W.Byers; Pearson Prentince Hall Bioengineering; ISBN: 0130664634 • Bioinformatics: Sequence and Genome Analysis; David W. Mount; Cold Spring Harbor; ISBN: 0879697121 • Introduction To Bioinformatics; Arthur M. Lesk; Oxford University Press ISBN: 0199277877 Ulf Schmitz, Introduction to molecular and cell biology

4. What is Bioinformatics? • Bioinformatics: is the development and use of computer applications for the Analysis, Interpretation, Simulation and Prediction of biological Systems and corresponding experimental methods in nature sciences. Ulf Schmitz, Introduction to molecular and cell biology

5. What is Bioinformatics? Ulf Schmitz, Introduction to molecular and cell biology

6. History of Bioinformatics • Biologists were searching for algorithms to analyze and interpret their huge amount of empiric biological data • As well as computer aided modeling and simulation • International molecular biological databases arose to make data internationally accessible and comparable • Algorithms for gene- and proteinprediction where developed • These efforts lead to the development of artificial neuronal networks, genetic algorithms and evolution strategies Ulf Schmitz, Introduction to molecular and cell biology

7. Bioinformatics • Offers an ever more essential input to • Molecular Biology • Pharmacology (drug design) • Agriculture • Biotechnology • Clinical medicine • Anthropology • Forensic science • Chemical industries (detergent industries, etc.) Ulf Schmitz, Introduction to molecular and cell biology

8. Organ Organism, Organ, Cell Organism Ulf Schmitz, Introduction to molecular and cell biology

9. The Cell Nucleus only in eukaryotic cells. Contains most of the cell's genetic material. The ER modifies proteins, makes macromolecules, and transfers substances throughout the cell. Ribosome translates mRNA into a polypeptide chain (e.g., a protein). Mitochondrion manufactures adenosine triphosphate (ATP), which is used as a source of energy. • circa 100 trillion (1014) cells in a human organism • 200 different forms of cells Ulf Schmitz, Introduction to molecular and cell biology

10. Function Genetics Biochemistry Proteins Genes Molecular Biology Molecular Biology • ... is the study of biology at a molecular level. • The field overlaps with other areas of biology, particularly genetics and biochemistry • Molecular biology concerns itself with understanding the interactions between the various systems of a cell, including the interrelationship of DNA, RNA and protein synthesis and learning how these interactions are regulated. Schematic relationship between biochemistry, genetics and molecular biology Ulf Schmitz, Introduction to molecular and cell biology

11. Biochemistry and Genetics • Biochemistry is the study of molecules (e.g. proteins). Biochemists take an organism or cell and dissect it into its molecular components, such as enzymes, lipids and DNA, and reconstitute them in test tubes (in vitro). • Genetics is the study of the effect of genetic differences on organisms. Often this can be inferred by the absence of a normal component (e.g. one gene). Ulf Schmitz, Introduction to molecular and cell biology

12. From Genes to Proteins DNA Gen mRNA Protein Ulf Schmitz, Introduction to molecular and cell biology

13. The Human Genome -- 26 June 2000 Ulf Schmitz, Introduction to molecular and cell biology

14. DNA • ~3.2 billion base pairs in every cell build the human genome • genes form only 1,5% of the human genome • a gene is a segment of the DNA, that encodes the constructon plan for a protein • in humans there are ca. 30,000 genes only Ulf Schmitz, Introduction to molecular and cell biology

15. Chromosome A chromosome is a very long, continuous piece of DNA, which contains many genes, regulatory elements and other intervening nucleotide sequences. http://www.tqnyc.org/NYC040844/Mitosis.htm Ulf Schmitz, Introduction to molecular and cell biology

16. Karyogram of human female Chromosome http://www.answers.com/topic/human-karyogram-png Ulf Schmitz, Introduction to molecular and cell biology

17. DNA - Sequence .....acctc ctgtgcaaga acatgaaaca cctgtggttc ttccttctcc tggtggcagc tcccagatgg gtcctgtccc aggtgcacct gcaggagtcg ggcccaggac tggggaagcc tccagagctc aaaaccccac ttggtgacac aactcacaca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc ccggtgccca gcacctgaac tcttgggagg accgtcagtc ttcctcttcc ccccaaaacc caaggatacc cttatgattt cccggacccc tgaggtcacg tgcgtggtgg tggacgtgag ccacgaagac cccgaggtcc agttcaagtg gtacgtggac ggcgtggagg tgcataatgc caagacaaag ctgcgggagg agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc aaccaagtca gcctgacctg cctggtcaaa ggcttctacc ccagcgacat cgccgtggag tgggagagca atgggcagcc ggagaacaac tacaacacca cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt gatgcatgag gctctgcaca accgctacac gcagaagagc ctctc..... Ulf Schmitz, Introduction to molecular and cell biology

18. DNA - Deoxyribonucleic acid • Deoxyribonucleic acid (DNA) forms a double stranded helix. • A sugar-phosphate backbone forms the outer shell on the helix • The two strands of DNA run in opposite directions. • Bases face towards each other and form hydrogen bonds • carries the generic instructions (genes) free Bases Cytosine - C Guanine - G Adenine - A Thymine - T complementary base pairs Ulf Schmitz, Introduction to molecular and cell biology

19. DNA - Deoxyribonucleic acid • A nucleotide is an organic molecule build of three components: • one out of five bases (A, G, C, T and U in RNA) • a pentose sugar (deoxyribose in DNA or ribose in RNA) • and a phosphate group. Nucleoside = Nucleobase + Pentose Nucleotide = Nucleobase + Pentose + Phosphate Group Ulf Schmitz, Introduction to molecular and cell biology

20. AMP GMP N N 5´ 4´ O O NH2 1´ NH2 N N O O 3´ 2´ O HO P N O HO P NH N N HO HO OH OH NH2 Phosphate Base Sugar CH3 NH2 O O O O 5´ N NH 4´ N N O 1´ 3´ 2´ O HO P O HO P HO O O HO OH OH TMP CMP DNA - Deoxyribonucleic acid Ulf Schmitz, Introduction to molecular and cell biology

21. C C G C G G C C G A T T S S S S S S S S S S S S P P P P P P P P P P P P P P P C A A T C G C G A C T A T A T C G T G T T G A G G T C G T C C T A C A G C A DNA base sugar phosphate Sugar Phosphate Backbone 3´ 5´ 5´ Base pair 3´ hydrogen bond [read as 3 prime and 5 prime] Ulf Schmitz, Introduction to molecular and cell biology

22. DNA - Molecule DNA-sequence (Alphabet: ATGC) CCTAGACATTGCTTTCCCATCCTGCTACTCAATGACAGTTTCTGGTTTCACTGGG TCACTCTCATCTTGATGCACTCCCGGGCAAGAGCTAACTGAAAGGCAGCTGCGT AACACATACCA GACACAACAGTTTATCATGGGAGAGTGAATTAAACCAGGAA... Ulf Schmitz, Introduction to molecular and cell biology

23. RNA – Ribonucleic acid In RNA the base Thymine (T) is replaced by Uracil (U). The other difference to DNA is that the sugar (Pentose) will be Ribose instead of Deoxiribose. Ribose has an additional hydroxyl group. Bases: Cytosine - C Guanine - G Adenine - A Uracil - U Uracil RNA transmits genetic information from DNA (via transcription) into proteins (by translation). RNA is almost exclusively found in the single-stranded form. Ulf Schmitz, Introduction to molecular and cell biology

24. RNA – Ribonucleic acid • RNA plays several roles in biology: • Messenger RNA (mRNA) is transcribed directly from a gene's DNA and is used to • encode proteins. • RNA genes are genes that encode functional RNA molecules; in contrast to mRNA, • these RNA do not code for proteins. The best-known examples of RNA genes are • transfer RNA (tRNA) and ribosomal RNA (rRNA). Both forms participate in the • process of translation, but many others exist. • RNA forms the genetic material (genomes) of some kinds of viruses. • Double-stranded RNA (dsRNA) is used as the genetic material of some RNA viruses • and is involved in some cellular processes, such as RNA interference. Ulf Schmitz, Introduction to molecular and cell biology

25. Proteins Proteins have a variety of roles that they must fulfil: • they are the enzymes that rearrange chemical bonds. • they carry signals to and from the outside of the cell, and within the cell. • they transport small molecules. • they form many of the cellular structures. • they regulate cell processes, turning them on and off and controlling their rates. Ulf Schmitz, Introduction to molecular and cell biology

26. Proteins – Amino Acids • there are 20 different types of amino acids (see below). • different sequences of amino acids fold into different 3-D shapes. • Proteins can range from fewer than 20 to more than 5000 amino acids in length. • Each protein that an organism can produce is encoded in a piece of the DNA called a “gene”. • the single-celled bacterium E.coli has about 4300 different genes. • Humans are believed to have about 30,000 different genes (the exact number as yet unresolved), Ulf Schmitz, Introduction to molecular and cell biology

27. Proteins – Amino Acids Protein-Sequence (Alphabet: ACDEFGHIKLMNPQRSTVWY): MENFQKVEKIGEGTYGVVYKARNKLTGEVVALKKIRLDTETEGVPSTAIREISLLK... • a typical human cell contains about 100 million proteins of about 10,000 types Ulf Schmitz, Introduction to molecular and cell biology

28. Proteins – Amino Acids • Properties of amino acids: • play a role in the construction of 3-D stuctures in proteins Ulf Schmitz, Introduction to molecular and cell biology

29. Proteins Primary protein structure is the sequence of a chain of amino acids Secondary protein structure occurs when the sequence of amino acids are linked by hydrogen bonds. Tertiary protein structure occurs when certain attractions are present between alpha helices and pleated sheets. Quaternary protein structure is a protein consisting of more than one amino acid chain. Ulf Schmitz, Introduction to molecular and cell biology

30. Proteins Ulf Schmitz, Introduction to molecular and cell biology

31. Proteins - Summary • DNA sequence determines protein sequence • Protein sequence determines protein structure • Protein structure determines protein folding and function Ulf Schmitz, Introduction to molecular and cell biology

32. Gene Expression Ulf Schmitz, Introduction to molecular and cell biology

33. Transcription Ulf Schmitz, Introduction to molecular and cell biology

34. Gene Expression - Transcription Messenger RNA (mRNA) Messenger RNA is RNA that carries information from DNA to the ribosome sites of protein synthesis in the cell. Once mRNA has been transcribed from DNA, it is exported from the nucleus into the cytoplasm, where it is bound to ribosomes and translated into protein. Non-coding RNA or "RNA genes" RNA genes (sometimes referred to as non-coding RNA or small RNA) are genes that encode RNA that is not translated into a protein. The most prominent examples of RNA genes are transfer RNA (tRNA) and ribosomal RNA (rRNA), both of which are involved in the process of translation. Ulf Schmitz, Introduction to molecular and cell biology

35. Translation Ulf Schmitz, Introduction to molecular and cell biology

36. Translation Ulf Schmitz, Introduction to molecular and cell biology

37. Translation Ulf Schmitz, Introduction to molecular and cell biology

38. Gene Expression - Translation • The genetic code is made up of • three letter 'words' (termed a • codon) formed from a sequence of • three nucleotides (e.g.. ACT, CAG, • TTT). • These codons can then be • translated with messenger RNA • and then transfer • RNA, with a codon corresponding • to a particular amino acid. • Since there are 64 possible • codons, most amino acids have • more than one possible codon. • There are also three 'stop' or • 'nonsense' codons signifying the • end of the coding region. Ulf Schmitz, Introduction to molecular and cell biology

39. A gene codes for a protein CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE Ulf Schmitz, Introduction to molecular and cell biology

40. Metabolic networksnext level of the functional/organisational hierarchy Protein networks guide the biochemistry of living cells Kegg database (Japan) Ulf Schmitz, Introduction to molecular and cell biology

41. Levels of the functional/organizational hierarchy Ulf Schmitz, Introduction to molecular and cell biology

42. Outlook – coming lecture • Genomics • Proteomics Ulf Schmitz, Introduction to molecular and cell biology

43. Introduction to molecular and cell biology Thanks for your attention! Ulf Schmitz, Introduction to molecular and cell biology