1 / 17

Protein Synthesis

Protein Synthesis. DNA. Double stranded Complimentary Composed of Nucleotides. DNA replication. DNA Helicase – breaks hydrogen bonds holding complimentary strands together Forms replication fork Leading strand Lagging strand. DNA Replication. DNA is read 5’ to 3’. Leading Stand.

alisa-cash
Download Presentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein Synthesis

  2. DNA • Double stranded • Complimentary • Composed of Nucleotides

  3. DNA replication • DNA Helicase – breaks hydrogen bonds holding complimentary strands together • Forms replication fork • Leading strand • Lagging strand

  4. DNA Replication DNA is read 5’ to 3’

  5. Leading Stand • Helicase -> RNA pimase -> DNA polymerase

  6. Lagging Stands • Helicase -> RNA primase -> DNA polymerase -> okazaki fragments -> DNA polymerase cleans up RNA primase strand -> DNA ligase

  7. Movie • Replication • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__dna_replication__quiz_1_.html • http://www.hhmi.org/biointeractive/dna-replication-advanced-detail

  8. Protein Synthesis 2 parts • Transcription • To copy segment of DNA • Translation • To translate the language of nitrogenous bases into amino acids

  9. RNA vs. DNA • Difference between mRNA and DNA • Single stranded vs. Double stranded • The sugar has an extra oxygen, ribose vs. deoxyribose • Uses uricil “U” instead of thymine

  10. Transcription • Production of mRNA • RNA primase binds to DNA at a promoter region • RNA polymerase adds bases copying the gene

  11. Movie • Transcription • http://www.dnalc.org/resources/3d/13-transcription-advanced.html

  12. Packaged • mRNA is processed to leave the nucleus • Extras are cut out • Splicosomes • Introns • Exons • Poly-A tail • 5’ cap

  13. Translation • mRNA has left the nucleus. • Binds with ribosome • mRNA -> tRNA -> amino acids -> folded proteins • What’s the Problem? • mRNA • UGGCUUGCAUGCCGGAGUCCACGUAAUCA Into • Amino acids A G C U Amino Acids

  14. Translation • tRNA consists of a • Anticodon– 3 bases that match codon • Amino acid • Codon – 3 base sequence on mRNA

  15. Translation • mRNA -> tRNA -> amino acids -> proteins

  16. Translation • mRNA • UGGCUUGCAUGCCGGAGUCCACGUAAUCA

  17. Movie • Translation • http://www.hhmi.org/biointeractive/translation-basic-detail

More Related