Shi et al, Supplemental Fig 2

Aug 14, 2014

10 likes | 91 Views

C. B. A. Shi et al, Supplemental Fig 2.

Share Presentation

Embed Code

Link

supplemental fig

amable

Download Presentation

Shi et al, Supplemental Fig 2

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

C B A Shi et al, Supplemental Fig 2

Abruzzi et al., Supplemental Table 2

Abruzzi et al., Supplemental Table 2.

197 views • 9 slides

Supplemental Fig. 1

Supplemental Fig. 1. p= 0.036. p= 0.29. p= 0.30. p= 0.77. Supplemental Fig. 2. p= 1.8 x10 -10. p= 6.9 x10 -9. Group 3 Group 4 SHH WNT. Group 3 Group 4 SHH WNT. p= 6.58 x 10 -6. p= 0.0002.

112 views • 3 slides

Supplemental Fig 2

Supplemental Fig 2 . A. B. C. R 2. %CV. Peptide number. Peptide number. Comparison of the coefficient of variation between TIQUAS and MRM. .

91 views • 1 slides

Supplemental Fig. S1

extracellular (P=0.000) cell wall (P=0.000) ribosome (P=0.001) ER (P=0.294) golgi apparatus (P=0.005) plasma membrane (P=0.000) mitochondria (P=0.000) cytosol (P=0.553) other cellular components (P=0.000) nucleus (P=0.000) other membranes (P=0.970) plastid (P=0.000)

263 views • 12 slides

Supplemental Fig. S2. Nishimura et al. PMB

Supplemental Fig. S2. Nishimura et al. PMB.

93 views • 1 slides

Lim et al ., Supplemental Fig. 2

A. B. C. D. E. Lim et al ., Supplemental Fig. 2.

76 views • 1 slides

Supplemental Fig. 2.

95 views • 1 slides

Wang et al. Supplementary Fig. 2

mAU. 16.2. BPB. 800. 21.6. BP-3HO. 600. BP-3HHx. 400. 17.4. 200. 0. 16. 18. 20. 22. 24. Time [min]. Wang et al. Supplementary Fig. 2.

104 views • 1 slides

Zang, et al. Supplemental Figure 2

Zang, et al. Supplemental Figure 2. Non-diabetic Diabetic Diabetic+S17834.

106 views • 1 slides

Supplemental FIG. S1

Supplemental FIG. S1. 1387 CAGUGCUUUAACUCUGUGCA UCACACUUGUCCUUUAAAUG 1427 GAGACUGUAAGCUUUUAUGA ACUUUUUUUACUUGGACACC 1467 ACUUUUACACAAAGUAUUUU GAAACAAAAGGCUAUAGGAA 1507 ACAUGAAAAGGUCAAAUGAU CAUUAUGCUGCUAUGGAGGA 1547 UGCUACUUGAUGGAGAUCAG CUGCUCGGGGCCAAGAAAAA

91 views • 1 slides

Supplemental Fig. S1 Awano et al

*. 0.10. D272NRNase R. 0.08. D280NRNase R. D. CsdA-. C. 0.06. Fraction unwound. 0.04. 0.02. 0.00. 0. 5. 10. 15. 20. 25. Time (min). Supplemental Fig. S1 Awano et al. A. CsdA- D C. RNase R-WT. D272NRNase R. D278NRNase R. D280NRNase R. Time (min).

118 views • 2 slides

Supplemental Fig.4

MoL #33472. Supplemental Fig.4. A B.

93 views • 1 slides

Supplemental Fig. 1

Supplemental Figure 1. Alignment of CALTPI and CALTPII proteins residues with tobacco lipid transfer protein1 (accession no. D13952).

130 views • 1 slides

Supplemental Fig. 2

Supplemental Fig. 2. a. 32Dp210. 32DP210. f. 32Dp210. g. 32Dp210. WP1193 ( m M) C 0.5 1.0 2.0 3.0 4.0. e. 32DP210. c. d. K562-R. C 15 30 45 60 (min).

97 views • 1 slides

Supplemental Fig.6

MoL #33472. Supplemental Fig.6. A B. C D.

74 views • 1 slides

Supplemental Fig. 2

Fabio Arturo Iannotti, Elisabetta Panza, Vincenzo Barrese, Davide Viggiano, Maria Virginia Soldovieri, and Maurizio Taglialatela. Expression, Localization, And Pharmacological Role Of Kv7 Potassium Channels In Skeletal Muscle Proliferation, Differentiation And Survival After Myotoxic Insults .

128 views • 1 slides

Supplemental Fig. 1

Supplemental Fig. 1. T-cell proliferation (cps 3 H thymidine). condition A - control. condition D - DCs pre-incubated in lenalidomide. condition C - T-cells pre-incubated in lenalidomide. condition B - lenalidomide present during co-culture. 1:10. 1:30. 1:100. 1:300. 1:1000.

168 views • 2 slides

Biajoux et al. Suppl. Fig 2

Biajoux et al. Suppl. Fig 2. A. B cells. Blood. Ficoll. Cryo. Relative cell number. CXCR4 MFI. B. *. **. % of CXCR4 + CD19 + CD27 - B cells. *. % of CXCR4 + CD19 + total B cells. *. % of CXCR4 + CD19 + CD27 + B cells. % of CXCR4 + CD19 low CD27 high B cells. **.

126 views • 1 slides

Supplemental Fig. 1

Supplemental Fig. 1 Live and dead cells estimated by trypan blue cell viability assay in 6-well plates. A. Experiment 1. A’. Experiment 2. d8. d6. d7. d4. d8. d1. d4. d2. d3. Live cells number (x10000). Live cells number (x10000). d1. *. *. *. *. *. *. *. *.

118 views • 1 slides

Supplemental Fig. S1. Nishimura et al. PMB

Supplemental Fig. S1. Nishimura et al. PMB. A. RlemMT1. B. RlemMT2.

88 views • 1 slides

Supplemental Fig. 1a

Supplemental Fig. 1a. UR. PR. R. FR. 9. 8. 7. 6. 5. 4. 3. 2. 1. 0. 10. Chemical shift (ppm). Supplemental Fig. 1b. UR. PR. R. FR. 9. 8. 7. 6. 5. 4. 3. 2. 1. 0. 10. Chemical shift (ppm). Supplemental Fig. 1c. UR. PR. R. FR. 9. 0. 8. 7. 6. 5.

159 views • 6 slides

Supplemental Fig.2

FNDC5. Absorption control. Gastrocnemius skeletal muscle. Subcutaneous w hite adipose tissue.

94 views • 1 slides

More Related