1 / 35

Last day to drop without a ‘ W ’ is September 16 th (this upcoming Sunday)

Last day to drop without a ‘ W ’ is September 16 th (this upcoming Sunday). Review about bases. They need to be very specific because they contain ALL the information for telling the cell how to function, so if they were flexible and changeable there would be problems

amandla
Download Presentation

Last day to drop without a ‘ W ’ is September 16 th (this upcoming Sunday)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Last day to drop without a ‘W’ is September 16th (this upcoming Sunday)

  2. Review about bases • They need to be very specific because they contain ALL the information for telling the cell how to function, so if they were flexible and changeable there would be problems • Nucleotides (bases) are RIGID/INFLEXIBLE because of the double bonds that make up the rings • Means that the H-bond donors and acceptors are always in the same place = specificity

  3. How? Why? Transcription: Writing again Translation: Changinglanguages

  4. Cytosine cries out for Guanine GUANINE http://en.wikipedia.org/wiki/Guanine

  5. Today we’ll go from here... To here We can do anything Text

  6. Off to see the wizard... Sending ‘messages’ out from DNA • DNA replication • both strands => new DNA • => new cell • Transcription • 1 strand => new RNA • => new protein

  7. Transcription: seeing it http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov

  8. Amino acids • From 4 letters of storage/information • to • 20 letters of action!!

  9. 20 toys • EVERY one has a blue part. Chem name? • EVERY one has a red part. Chem name? • Thus these are all...?

  10. Amino Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • How many are there? • Possible?

  11. Amino Acids • You & partner have an amino acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids)

  12. Nucleic Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • Which is more diverse in terms of shape and ‘feel’? • Which would allow for more diverse shapes and surfaces when ‘connected’?

  13. Different tools; different jobs • In what ways are all bases identical? Different? • In what ways are all amino acids identical? Different? • Which set is more diverse in terms of ‘feel’? • Which more diverse in terms of shape? • Which would allow you to build more diverse shapes & surfaces?

  14. How does a codon ‘mean’ an amino acid?

  15. Walking the walk • How bio machines translate the language of nucleotides into an amino acid string

  16. Biology: because it has to work like that way • Von Neumann argued that... [self-reproducing] machines would need to store separately the information needed to make the machine and would need to have a mechanism to interpret that information—a tape and a tape reader. In effect, he abstractly described the gene, the ribosome, and the messenger. --Matt Ridley in Francis Crick, discoverer of the genetic code

  17. Types of bonds • VELCRO: a bond that can be cheerfully broken/re-made during lab • Duct tape: same at the molecular level, but at the 181L student level, breaking such a bond gets you a zero on this week’s quiz

  18. Blinding you with Science (jargon) • RNA Polymerase: joins RNA links into a chain • mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA • tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids • ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide • aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs • Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart

  19. DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’

  20. DNA template strand(alternate version) 5’ CTTAAATCCGAATGCCCATG 3’ 5’ end is pointy/spiky 3’ end is soft/furry

  21. Wielding the Power • ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

  22. Walk-through with 1 tRNA • Everybody watches visits to synthetase, ribosome • In the real world, everything is happening all the time; all is happenstance

  23. Roles--for single mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 4 tRNA (1-2 people) • 4 pairs to be synthetases • 1 small ribosomal subunit x 2 • 1 large ribosomal subunit x 2 • 2 to be (RNA polymerase & the RNA it makes ) • 1 termination factor (1-2 people)

  24. Roles--for TWO mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 4 tRNA • 4 synthetases • 1 ribosome • 1-2 to be (RNA polymerase & the RNA it makes ) • 1 termination factor

  25. Learning your ‘lines’ • Handout: Each group find questions related to their role; answer them • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry

  26. Choreographing translation • A play of many parts, many players, no brains

  27. tRNA PICTURES OF SOME OF THE PLAYERS Amino Acid is the yellow bit synthetase

  28. Ready…. Go! • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops, molecules involved will announce, explain • Go until a protein happens Includes ‘didn’t work’

  29. Who knows the code? • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon

  30. Review movie • (in TA desktop folder)

  31. Exit Condition • 1.) Pair up (two in a group) • 2.) Write your names and SECTION at the top of the paper • 3.) EXPLAIN the process of TRANSLATION • Include the following in your answer: • tRNA • mRNA • ribosome • UAG codon • RNA Polymerase • aminoacyl tRNA synthetase • termination factor • diffusion/Brownian motion • **Worth 10 pts on next week’s quiz

  32. Meet your semester-long interest

  33. Homework • StructViewer*--amino acid look & feel** • Begin thinking about your project • Assessor: mutation & translation • *As will always be the case in this course, no tricks; focus on the primary idea(s) • **‘SurfaceViewer’ link from Software page may help • ...Ch. 3 reading about the immune system is just for fun

More Related