Genes and Protein Synthesis

1. Genes and Protein Synthesis Chapter 7

2. One Gene-One Polypeptide Hypothesis • DNA contains all of our hereditary information • Genes are located in our DNA • ~25,000 genes in our DNA (46 chromosomes) • Each Gene codes for a specific polypeptide

3. Main Idea • Central Dogma • Francis Crick (1956)

4. Overall Process Gene 1 Gene 3 DNA molecule • Transcription • DNA to RNA • Translation • Assembly of amino acids into polypeptide • Using RNA Gene 2 DNA strand TRANSCRIPTION RNA Codon TRANSLATION Polypeptide Amino acid

5. Key Terms • RNA transcription • Initiation, Elongation, Termination • TATA box • Introns, Exons • mRNA, tRNA, rRNA • Translation • Ribosome • Codon • Amino Acids • Polypeptide

7. DNA to Protein Gene 1 Gene 3 DNA molecule • Protein is made of amino acid sequences • 20 amino acids • How does DNA code for amino acid? Gene 2 DNA strand TRANSCRIPTION RNA Codon TRANSLATION Polypeptide Amino acid

8. Genetic Code • Codon • Three letter code • 5’ to 3’ order • Start codon • Stop codon • AA are represented by more than one codon • 61 codons that specify AA

9. Amino acids • Abbreviated • Three letters

10. RNA polymerase Transcription DNA of gene Promoter DNA Terminator DNA Initiation • DNA to RNA • Occurs in nucleus • Three process • Initiation • Elongation • Termination Elongation Termination GrowingRNA Completed RNA RNApolymerase

11. Initiation • RNA polymerase binds to DNA • Binds at promoter region • TATA box • RNA polymerase unwinds DNA • Transcription unit • Part of gene that is transcribed • Transcription factors bind to specific regions of promoter • Provide a substrate for RNA polymerase to bind beginning transcription • Forms transcription initiation complex

12. Elongation • RNA molecule is built • RNA polymerase • Primer not needed • 5’ to 3’ direction • Template strand is copied • 3’ to 5’ DNA • Coding strand • DNA strand that is not copied • Produces mRNA • Messenger RNA • DNA double helix reforms

13. Termination • RNA polymerase recognizes a termination sequence – AAAAAAA (polyadenylation) • Nuclear proteins bind to string of UUUUUU on RNA • mRNA molecule releases from template strand

15. Post-Transcriptional Modifications • Pre-mRNA undergoes modifications before it leaves the nucleus • Poly(A) tail • Poly-A polymerase • Protects from RNA digesting enzymes in cytosol • 5’ cap • 7 G’s • Initial attachment site for mRNA’s to ribosomes • Removal of introns

16. Splicing the pre-mRNA • DNA comprised of • Exons • sequence of DNA or RNA that codes for a gene • Introns • non-coding sequence of DNA or RNA • Spliceosome • Enzyme that removes introns from mRNA

17. Splicing Process • Spliceosome contains a handful of small ribonucleoproteins • snRNP’s (snurps) • snRNP’s bind to specific regions on introns

18. Alternative Splicing • Increases number and variety of proteins encoded by a single gene • ~25,000 genes produce ~100,000 proteins

19. Translation • mRNA to protein • Ribosomes read codons • tRNA assists ribosome to assemble amino acids into polypeptide chain • Takes place in cytoplasm

20. tRNA • Contains • triplet anticodon • amino acid attachment site • Are there 61 tRNA’s to read 61 codons?

21. tRNA: Wobble Hypothesis • First two nucleotides of codon for a specific AA is always precise • Flexibility with third nucleotide • Aminoacylation • process of adding an AA to a tRNA • Forming aminoacyl-tRNA molecule • Catalyzed by 20 different aminoacyl-tRNAsynthetase enzymes

22. Ribosomes • Translate mRNA chains into amino acids • Made up of two different sized parts • Ribosomal subunits (rRNA) • Ribosomes bring together mRNA with aminoacyl-tRNAs • Three sites • A site - aminoacyl • P site – peptidyl • E site - exit

23. Amino acid Translation process Polypeptide Asite P site Anticodon mRNA 1 Codon recognition • Three stages • Initiation • Elongation • Termination mRNAmovement Stopcodon Newpeptidebond 2 Peptide bond formation 3 Translocation

24. Initiation • Ribosomal subunits associate with mRNA • Met-tRNA (methionine) • Forms complex with ribosomal subunits • Complex binds to 5’cap and scans for start codon (AUG) (scanning) • Large ribosomal subunit binds to complete ribosome • Met-tRNA is in P-site • Reading frame is established to correctly readcodons

25. Elongation • Amino acids are added to grow a polypeptide chain • A, P, and E sites operate • 4 Steps

26. Termination • A site arrives at a stop codon on mRNA • UAA, UAG, UGA • Protein release factor binds to A site releasing polypeptide chain • Ribosomal subunits, tRNA release and detach from mRNA

27. polysome b a What molecules are present in this photo? Red object = ?

28. Review • What is a gene? • Where is it located? • What is the main function of a gene? • Do we need our genes “on” all the time? • How do we turn genes “on” or “off”?

29. Regulating Gene Expression • Proteins are not required by all cells at all times • Regulated • Eukaryotes – 4 ways • Transcriptional (as mRNA is being synthesized) • Post-transcriptional (as mRNA is being processed) • Translational (as proteins are made) • Post-translational (after protein has been made)

30. Transcriptional regulation • Most common • DNA wrapped around histones keep gene promoters inactive • Activator molecule is used (2 ways) • Signals a protein remodelling complex which loosen the histones exposing promoter • Signals an enzyme that adds an acetyl group to histones exposing promoter region

31. Transcriptional regulation • Methylation • Methyl groups are added to the cytosine bases in the promoter of a gene (transcription initiation complex) • Inhibits transcription – silencing • Genes are placed “on hold” until they are needed • E.g. hemoglobin

32. Post transcriptional regulation • Pre-mRNA processing • Alternative splicing • Rate of mRNA degradation • Masking proteins used to degrade mRNA • Translation does not occur • Embryonic development • Hormones • Casein – milk protein in mammary gland • When casein is needed, prolactinis produced extending lifespan of casein mRNA

33. Translational regulation • Occurs during protein synthesis by a ribosome • Changes in length of poly(A) tail • Enzymes add or delete adenines • Increases or decreases time required to translate mRNA into protein • Environmental cues

34. Post-Translational Regulation • Processing • Removes sections of protein to make it active • Cell regulates this process (hormones) • Chemical modification • Chemical groups are added or deleted • Puts the protein “on hold” • Degradation • Proteins tagged with ubiquitin are degraded • Amino acids are recycled for protein synthesis

35. Cancer • Lack regulatory mechanisms • Mutations in genetic code (mutagens) • Probability increases over lifetime • Radiation, smoking, chemicals • Mutations are passed on to daughter cells • Can lead to a mass of undifferentiated cells (tumor) • Benign and malignant • Oncogenes • Mutated genes that once served to stimulate cell growth • Cause undifferentiated cell division

36. Genetic Mutations • Positive and negative • Natural selection – evolution • Cancer –death • Small-Scale – single base pair • Point mutations • Substitution, insertion/deletion, inversion • Large-Scale – multiple base pairs

37. Small-Scale Mutations • Four groups • Missense, nonsense, silent, frameshift • Lactose, sickle cell anemia • SNPs – single nucleotide polymorphisms • Caused by point mutations

38. Missense mutation • Change of a single base pair or group of base pairs • Results in the code for a different amino acid • Protein will have different sequence and structure and may be non-functional or function differently

39. Nonsense mutation • Change in single base pair or group of base pairs • Results in premature stop codon • Protein will not be able to function

40. Silent Mutation • Change in one or more base pairs • Does not affect functioning of a gene • Mutated DNA sequence codes for same amino acid • Protein is not altered

41. Frameshift mutation • One or more nucleotides are inserted/deleted from a DNA sequence • Reading frame of codons shifts resulting in multiple missense and/or nonsense effects • Any deletion or insertion of base pairs in multiples of 3 does not cause frameshift

42. Large-scale mutations • Multiple nucleotides, entire genes, whole regions of chromosomes

43. Large-scale mutations • Amplification – gene duplication • Entire genes are copied to multiple regions of chromosomes

44. Large-scale mutations • Large-scale deletions • Entire coding regions of DNA are removed • Muscular Dystrophy

45. Large-scale mutations • Chromosomal translocation • Entire genes or groups of genes are moved from one chromosome to another • Enhance, disrupt expression of gene

46. Large-scale mutations • Inversion • Portion of a DNA molecule reverses its direction in the genome • No direct result but reversal could occur in the middle of a coding sequence compromising the gene

47. Large-scale mutations • Trinucleotide repeat expansion • Increases number of repeats in genetic code • CAG CAGCAGCAGCAGCAGCAGCAG • Huntingtons disease

48. Causes of genetic mutations • Spontaneous mutations • Inaccurate DNA replication • Induced mutations • Caused by environmental agent – mutagen • Directly alter DNA – entering cell nucleus • Chemicals, radiation

49. Chemical Mutagens • Modify individual nucleotides • Nucleotides resemble other base pairs • Confuses replication machinery – inaccurate copying • Nitrous acid • Mimicking DNA nucleotides • Ethidium bromide – insert itself into DNA

50. Radiation - Low energy • UV B rays • Non-homologous end joining • Bonds form between adjacent nucleotides along DNA strand • Form kinks in backbone • Skin cancer