1 / 21

Important Terms

Important Terms 1) Genetics is the study of biologically inherited traits or (biological heredity). 2) I nherited traits are determined by the elements (units) of heredity ( genes ). A gene is a region of DNA containing genetic information.

austin-mercado
Download Presentation

Important Terms

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Important Terms 1) Genetics is the study of biologically inherited traits or (biological heredity). 2) Inherited traits are determined by the elements (units) of heredity (genes). Agene is a region of DNA containing genetic information. 3) Genome is the total of DNA in a single cell of the organism.

  2. 4)Genomics is the latest advance in molecular genetics. It deals with the DNA sequence, organization, function, and evolution of genomes. 5)Proteome is the complete set of proteins encoded in the genome. 6)Proteomics is the study of the complement of proteins presentin a cell or organism in order to identify their cellular localization, functions, and interactions.

  3. genotype Is the genetic constitution of a cell (organism)

  4. phenotype Is the observable properties of an organism (including its visible traits)

  5. Alleles? Alleles are the different forms of particular gene.

  6. Heterozygous genotype The genotype in which the pair of alleles are different.

  7. Homozygous genotype The genotype in which the pair of alleles are alike.

  8. Dominant trait Is that expressed in the phenotype when the genotype is either heterozygous or homozygous.

  9. Recessive trait Is that expressed in the phenotype when the genotype is homozygous

  10. Complementary base pairing It is the base pairing between A and T and between C and G. The complement of A is T and the complement of C is G.

  11. RNA 1) RNA contains the sugar ribose instead of deoxyribose in DNA. 2) RNA is single stranded. 3) RNA contains the base uracil (U) instead of thymine (T) which is present in DNA.

  12. Transcription & Translation One strand of DNA directs the synthesis of a molecule of RNA (ribonucleic acid). (this is called transcription and the RNA made is called transcript). Messenger RNA (mRNA) carries genetic information from DNA and is used as a template for polypeptide synthesis. (this is called translation).

  13. 3Types of RNA to make protein 1) Messenger RNA which is used as a template for synthesis of protein. 2) Ribosomal RNA (rRNA) which has four types and on which polypeptide synthesis takes place. 3) Transfer RNA (tRNA): it is a set of tRNA, each of which carries a particular amino acid as well as a three-base recognition area to bind 3 adjacent bases in mRNA.

  14. Mutation Mutation refers to any heritable change in a gene or in the genetic material in general. It refers also to the process by which a change takes place. Mutant is the result of mutation. Mutant RNA, mutant DNA, mutant protein.

  15. Sickle cell hemoglobin GAG: codon on mRNA for glutamic acid (Aa) GUG: codon on mRNA for valine (Aa) wildtypemutant DNA: 5’…GAG… …GTG…3’ DNA(T): 3’…CTC… ... CAC …5’ mRNA: 5’…GAG… …GUG…3’ So glutamic acid will be replaced by valine.

  16. In the human gene for the β chain of hemoglobin, the first 21 nucleotides in the amino-acid-coding have the sequence: 3'- TACCACGTGGACTGAGGACTC -5' 1) Deduce the base sequence of the mRNA in this coding region? 2) What is the amino acid sequence in this part of β chain of hemoglobin

  17. 3'- TACCACGTGGACTGAGGACAC -5‘ What is the amino acid replacement?

More Related