1 / 61

Issues, Concepts and Tools for Analysis of Fungal Environmental ITS Sequences D. Lee Taylor

Issues, Concepts and Tools for Analysis of Fungal Environmental ITS Sequences D. Lee Taylor ltaylor@iab.alaska.edu Shawn Houston houston@alaska.edu Institute of Arctic Biology University of Alaska Fairbanks Photograph: Roger Ruess.

becky
Download Presentation

Issues, Concepts and Tools for Analysis of Fungal Environmental ITS Sequences D. Lee Taylor

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Issues, Concepts and Tools for Analysis of Fungal Environmental ITS Sequences D. Lee Taylor ltaylor@iab.alaska.edu Shawn Houston houston@alaska.edu Institute of Arctic Biology University of Alaska Fairbanks Photograph: Roger Ruess

  2. Coupling Diversity with Function: Metagenomics of Boreal Forest Fungi USDA-NSF Microbial Genome Sequencing Program, 2003-2007 IPY: A Community Genomics Investigation of Fungal Adaptation to Cold NSF OPP International Polar Year, 2007-2011 Major Clone Datasets To Date: • Upland successional stages, Bonanza Creek LTER site 30,000 • Various black spruce community types, Interior Alaska 40,000 • Two individual floodplain black spruce soil cores 20,000 • Seasonal study in single white spruce site, Interior Alaska 9,200 • Moist sites along North American Arctic Transect, bioclimatic subzones A-E 9,200 • Moist sites at Svalbard, subzones B, C 3,000 • Snow addition experiment at Toolik Lake LTER tundra site3,800

  3. Bioinformatic Processing of Fungal ITS Sequences from the Environment • Initial sequence cleanup -> Quality Scores -> Masking if Sanger Sequences • Bar-coding/tagging -> Long, bias tested, edit distance -> Tag-finder script • Chimeras -> Uclust • Defining OTUs • Introns -> TGICL/Cap3 Genome Assemblers • Percent Identity Thresholds -> Phylobinning • Pseudogenes -> ??? • Identifying OTUs • Curated databases with masking of conserved seqs • SIMPLE DEMO/TUTORIAL

  4. ftp://folders.inbre.alaska.edu/FMP/ http://www.borealfungi.uaf.edu/pipeline/

  5. V Kunin, A Engelbrektson, H Ochman and P Hugenholtz. 2010. Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environmental microbiology 12:118–123.

  6. Bioinformatic Processing of Fungal ITS Sequences from the Environment • Initial sequence cleanup -> Quality Scores -> Masking if Sanger Sequences • Bar-coding/tagging -> Long, bias tested, edit distance -> Tag-finder script • Chimeras -> Uclust • Defining OTUs • Introns -> TGICL/Cap3 Genome Assemblers • Percent Identity Thresholds -> Phylobinning • Pseudogenes -> ??? • Identifying OTUs -> Curated databases with masking of conserved seqs

  7. Design of Pig-Tagged Primers Taylor DL, Booth MG, McFarland JW, Herriott IC, Lennon NJ, Nusbaum C & Marr TG. 2008. Increasing ecological inference from high throughput sequencing of fungi in the environment through a tagging approach. Molecular Ecology Resources 8(4): 742 - 752.

  8. 4 Taxon Test for Biases Taylor DL, Booth MG, McFarland JW, Herriott IC, Lennon NJ, Nusbaum C & Marr TG. 2008. Increasing ecological inference from high throughput sequencing of fungi in the environment through a tagging approach. Molecular Ecology Resources 8(4): 742 - 752.

  9. Soil Sample Tests for Biases • Soil 1 Soil 2 . • OTUTag064Tag102Tag067Tag126Grand Total • 1 13 14 37 35 99 • 34 9 8 10 3 30 • 32 7 7 5 4 23 • 29 12 10 0 0 22 • 25 9 9 0 0 18 • 14 2 0 7 5 14 • 26 6 4 0 3 13 • 4 2 2 5 3 12 • 30 0 0 8 4 12 • 17 3 3 2 2 10 • 2 0 2 1 5 8 • 5 2 0 2 3 7 • 19 5 2 0 0 7 • 23 0 0 3 4 7 • 40 2 0 2 3 7 • 3 0 0 3 3 6 • 31 4 1 1 0 6 • 7 1 2 0 2 5 • 18 0 0 1 4 5 • 11 1 1 1 1 4 • 12 2 0 1 1 4 • 21 1 3 0 0 4 • 41 1 3 0 0 4

  10. Bioinformatic Processing of Fungal ITS Sequences from the Environment • Initial sequence cleanup -> Quality Scores -> Masking if Sanger Sequences • Bar-coding/tagging -> Long, bias tested, edit distance -> Tag-finder script • Chimeras -> Uclust • Defining OTUs • Introns -> TGICL/Cap3 Genome Assemblers • Percent Identity Thresholds -> Phylobinning • Pseudogenes -> ??? • Identifying OTUs • Curated databases with masking of conserved seqs • SIMPLE DEMO/TUTORIAL

  11. Challenges: Chimeras Reports in literature up to 30% of clone datasets 3% in our earliest clone libraries <1% in a 30,000 clone black spruce dataset* Currently used detection methods depend upon global MSA and/or library of clean reference sequences

  12. STEP 1: Identify 97% contigs that are represented in multiple libraries. Sequences belonging to these contigs are deemed to be real and non-chimeric. STEP 2: BLAST sequences against all known databases of fungi (including GenBank and lab databases) and identify passing matches (queries) STEP 3: BLAST ITS1 and ITS2 of remaining sequences against curated database hunting for 97+% matches of both sides to same species. Sequences for which both the ITS1 and ITS2 regions match the same species at 97+% over 200+ bp are considered real and non-chimeric. STEP 4: BLAST ITS1 and ITS2 sequences against database from which they came (including all libraries), hunting for matches to possible chimera parents STEP 5: Align full length queries against best ITS1 and ITS2 matches, examine by eye

  13. First Uclust test runs on fungal ITS sequences: • dataset of 45 OTUs with ITS plus 600bp LSU • 10 out of 10 synthetic chimeras detected, including intrageneric • only 2 real sequences suggested as possible chimeras, with low probability • examined another dataset of 547 real, relatively reliable sequences • spits out 3 way alignments that can be examined • Bellerophon suggested 53% chimeric, Uclust found ZERO

  14. Bioinformatic Processing of Fungal ITS Sequences from the Environment • Initial sequence cleanup -> Quality Scores -> Masking if Sanger Sequences -> Orienting to fix direction • Bar-coding/tagging -> Long, bias tested, edit distance -> Tag-finder script • Chimeras -> Uclust • Defining OTUs • Introns -> TGICL/Cap3 Genome Assemblers • Percent Identity Thresholds -> Phylobinning • Pseudogenes -> ??? • Identifying OTUs -> Curated databases with masking of conserved seqs

  15. SSU ITS-1 5.8S ITS-2 LSU • Challenges: Arbitrary % Identity Thresholds • Multicopy • Intra-individual variation (including pseudogenes) • Intra-specific variation • Different rates of evolution in different lineages • How does 97% identity threshold perform?

  16. Groupings Differ Depending on Alignment Program and Parameter Settings

  17. X. Huang & A. Madan. 1999. Genome Research 9: 868-877

  18. Geml J, Laursen GA, Timling I, McFarland J, Booth MG, Lennon N, Nusbaum HC, Taylor DL. 2009. Molecular Ecology 18: 2213–2227. ITS phylogram of LactariusML tree, thick branches have >0.95 Bayesian Posterior Probability OTU 13 (97% ITS sim.)

  19. OTU 19 (97% ITS sim.) Geml J, Laursen GA, Timling I, McFarland J, Booth MG, Lennon N, Nusbaum HC, Taylor DL. 2009. Molecular Ecology 18: 2213–2227. OTU 12 (97% ITS sim.)

  20. Our Phylobinning Approach: • cluster with Cap3 at low % identity (90%) • extract sequences from clusters • find related sequences in GenBank (everything & uncultured excluded) • generate alignments for each cluster using Muscle • feed alignments to RAxML • use fast-bootstraping method and find best tree using maximum likelihood • parse tree to determine phylobins • If branch length > 0.001 AND bootstrap >= 98, then name new phylobin • If branch length < 0.01 AND bootstrap < 98, move to next cluster • If branch length >= 0.01 AND bootstrap < 70, then move to next cluster • If branch length >= 0.01 AND bootstrap >= 70, then name new phyobin • If branch length >= 0.03, then name new phylobin • (even if individual sequence) • All sequences from a contig that are not assigned to a phylobin at this point go into a last, default phylobin

  21. Systematic Biology 57(5): 758–771, 2008 {RAxML version 7.0.4 released by Alexandros Stamatakis in April 2008}

  22. TKN7_3179P22 phylobin18 *gi|133753088| Uncultured fungus clone G20_OT phylobin18 *gi|133753170| Uncultured fungus clone TD9_OT phylobin18 TKN12_3255J11 phylobin19 TKN12_3258A12 phylobin20 TKN9_3238J10 phylobin21 *gi|37624773| Mycorrhizal fungal sp. pkc18 1 phylobin21 *gi|37624772| Mycorrhizal fungal sp. pkc33 1 phylobin21 *gi|37624762| Mycorrhizal fungal sp. pkc38 1 phylobin21 TKN10_3235I22 phylobin21 TKN11_3260O3 phylobin21 *gi|37624759| Mycorrhizal fungal sp. pkc12 1 phylobin21 *gi|37624763| Mycorrhizal fungal sp. pkc22 1 phylobin21 *gi|162311725| Uncultured fungus clone IH_Tag phylobin22 TKN12_3249H16 phylobin22 22 Uncultured fungus clone IH_Tag102_3331 TKN12_3249H16 TKN9_3238J10 20 TKN12_3258A12 Mycorrhizal fungal sp. pkc09 Mycorrhizal fungal sp. pkc18 Mycorrhizal fungal sp. pkc33 21 Mycorrhizal fungal sp. pkc38 TKN10_3235I22 TKN11_3260O3 Mycorrhizal fungal sp. pkc12 Mycorrhizal fungal sp. pkc22 19 TKN12_3255J11 TKN7_3179P2 18 Uncultured fungus clone G20_OTU5 Uncultured fungus clone TD9_OTU5 Hyalodendriella betulae Cistella acuum Meliniomyces bicolor

  23. Bioinformatic Processing of Fungal ITS Sequences from the Environment • Initial sequence cleanup -> Quality Scores -> Masking if Sanger Sequences -> Orienting to fix direction • Bar-coding/tagging -> Long, bias tested, edit distance -> Tag-finder script • Chimeras -> Uclust • Defining OTUs • Introns -> TGICL/Cap3 Genome Assemblers • Percent Identity Thresholds -> Phylobinning • Pseudogenes -> ??? • Identifying OTUs -> Curated databases with masking of conserved seqs

  24. Challenges: Pseudogenes • Sequences from cultures and fruitbodies for phylogenetics are rarely cloned - usually averages of variants that equate with the dominant sequence type • Pseudogenes found in ITS clone libraries of Zooxanthellae

  25. Thornhill, Lajeunesse & Santos. 2007. Molecular Ecology 16: 5326-5340.

  26. “Based on these results, we conclude that artefacts due to Taq polymerase and cloning error only account for a small percentage of our clones while the remaining sequence diversity and divergence originates from ribosomal operon variation within the Symbiodinium Genome.”

  27. Challenges: Non-fungal Sequences LSU 5.8S 30,000 black spruce clones Primers ITS1-F and TW13

  28. Bioinformatic Processing of Fungal ITS Sequences from the Environment • Initial sequence cleanup -> Quality Scores -> Masking if Sanger Sequences -> Orienting to fix direction • Bar-coding/tagging -> Long, bias tested, edit distance -> Tag-finder script • Chimeras -> Uclust • Defining OTUs • Introns -> TGICL/Cap3 Genome Assemblers • Percent Identity Thresholds -> Phylobinning • Pseudogenes -> ??? • Identifying OTUs -> Curated databases with masking of conserved seqs

  29. >TKN14_3314_P9 CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATTATAG GTGAGGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCCGAGCCCTTAATCCACACACACCTGTGAACCTATTGTAAGG GCCCTTAAAAAAGGCCTTTACGTCTTATCATCAACCCATCGTATGTCTCATAGAATGTAAATATATGTCCTCGCCTTAAA AAGCGTTGATAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATA AGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATG CCTGTTTGAGTGTCATTAAATTCTCAACTCTGATCGATTTGTTTCGACTTCGGAGCTTGGATTTGGAGCGTGCTGGCGTC GGTCGGCTCCTCTTAAATGCATCAGCGGAATCTAACGTTTCGGACGTCAGTGTGATAATCATGTTGCGCTGTCTGCCTGA TCTGAAAGCCCGCTCACAATGGTCTTCGGACAACTTCATATCAAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAAC TTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAA TTTAAAATCTGGCGGTCTTGCGGCCGTCCGAGTTGTAATCTGGAGAAGCGTTTATCCGCGTCGGACCGTGTACAAGTCTT CTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACAACCGGTGCTTTTGTGATGCGCTCTCGAAGAG TCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAA CAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGTTT GAAGTCAGTCGCGTCGGCCGAGACTCAACCTTGCTTCTGCTCGGTGCACTTCTCGGTTGACGGGTCAGCATCAATTTTGA CCGCCGGATAAAGGTCGGGGGAATGTGGCATCCTTCGGGATGTGTTATAGACCTCGATTCGGATACGGCGATTGGGATTG AGGAACTCGGCGCTTTGCGTCCAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGANC >TKN14_3314_P9 CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAA CCTGCGGAAGGATCATTATTGAAATTATAGGTGAGGGTTGTAGCTGGCCT CTCGGGGCATGTGCACGCCCGAGCCCTTAATCCACACACACCTGTGAACC TATTGTAAGGGCCCTTAAAAAAGGCCTTTACGTCTTATCATCAACCCATC GTATGTCTCATAGAATGTAAATATATGTCCTCGCCTTAAAAAGCGTTGAT AAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAA GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAAT CATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATG CCTGTTTGAGTGTCATTAAATTCTCAACTCTGATCGATTTGTTTCGACTT CGGAGCTTGGATTTGGAGCGTGCTGGCGTCGGTCGGCTCCTCTTAAATGC ATCAGCGGAATCTAACGTTTCGGACGTCAGTGTGATAATCATGTTGCGCT GTCTGCCTGATCTGAAAGCCCGCTCACAATGGTCTTCGGACAACTTCATA TCAAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNCGTCTTGAAACACGGANC

  30. query match bit score E value -------- -------- ---------- ---------- TKN14_3314_P9 gi|56126498|gb|AY822743.1| Uncultured ectomycor 1168 0.0 TKN14_3314_P9 gi|296184581|gb|AY884238.2| Ectomycorrhizal fun 1168 0.0 TKN14_3314_P9 gi|299778250|gb|HM069482.1| Uncultured fungus c 1128 0.0 TKN14_3314_P9 gi|13470319|gb|AY010281.1| Piloderma fallax iso 1100 0.0 TKN14_3314_P9 gi|104295534|gb|DQ474631.1| Uncultured ectomyco 1100 0.0 query match bit score E value -------- -------- ---------- ---------- TKN14_3314_P9 gi|296184581|gb|AY884238.2| Ectomycorrhizal fun 1168 0.0 TKN14_3314_P9 gi|13470319|gb|AY010281.1| Piloderma fallax iso 1100 0.0 TKN14_3314_P9 gi|13470320|gb|AY010282.1| Piloderma fallax iso 1066 0.0 TKN14_3314_P9 gi|86610857|gb|DQ365660.1| Piloderma fallax iso 1025 0.0 TKN14_3314_P9 gi|86610864|gb|DQ365667.1| Piloderma fallax iso 1025 0.0 query: TKN14_3314_P9 Click here to see the sequences of the best scores The best scores are: gi|296184581|gb|AY884238.2| Ectomycorrhizal fun cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; unclassified Fungi; ectomycorrhizal fungal sp. AR-Ny2 gi|13470319|gb|AY010281.1| Piloderma fallax iso cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Atheliales; Atheliaceae; Piloderma; Piloderma fallax gi|13470320|gb|AY010282.1| Piloderma fallax iso cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Atheliales; Atheliaceae; Piloderma; Piloderma fallax gi|86610857|gb|DQ365660.1| Piloderma fallax iso cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Atheliales; Atheliaceae; Piloderma; Piloderma fallax gi|86610864|gb|DQ365667.1| Piloderma fallax iso cellular organisms; Eukaryota; Fungi/Metazoa group; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Atheliales; Atheliaceae; Piloderma; Piloderma fallax

  31. Funding Sources and Supporting Agencies

  32. Thanks! Michelle Augustyn Michael Booth Dan Cardin József Geml Hope Gray Ian Herriott Scott Hillard Teresa Hollingsworth Sarah Hopkins Jason Hunt Tom Marr Jack McFarland Chad Nusbaum Gary Laursen Niall Lennon Jim Long Mitali Patil Ina Timling

  33. Mask (marking low quality base calls) Tag-Finder (identifying primer bar-codes) Orient (fixing sequence directions) Trim-Seq (removing low quality bases at ends) Purge (removing low quality sequences) Flag Non-Fungals Prepare_contigs (BLAST + Organism Lookup)(TGICL/Cap3 broad clusters) (BLAST to add close relatives) (Muscle cluster alignments) Flag Chimeras Phylo_table (Uclust) (RAxML bootstrap trees) (Tree parsing) Final Phylobin Table (Closest BLAST Relatives) (Abundances of Phylobins across Samples) (Any Flags)

  34. ftp://folders.inbre.alaska.edu/FMP/ http://www.borealfungi.uaf.edu/pipeline/

  35. ftp://folders.inbre.alaska.edu/FMP/ http://www.borealfungi.uaf.edu/pipeline/

  36. Upload sequences in .fasta format here Place phred threshold here (phred = 20 is conservative) Upload quality file here (.qual file) ftp://folders.inbre.alaska.edu/FMP/ http://www.borealfungi.uaf.edu/pipeline/

  37. >R_UP1_3168_P8 CAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGG TGAACCAGCGGAGGGATCATTACCGAGTTTACAAACTCCCAAACCCTTTG TGAACCTTACCTATCGTTGCTTCGGCGGGACCGCCCCGACGGCCACCTCG GTGGTCCCGGAACCAGGCGCCCGCCGAAGGCCCCAAACTCTTTGTTTCCT ATGGTTTTCTCCTCTGAGTGGAAAATAAACAAATAAATAAAAACTTTCAA CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAT AAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC ATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCA ACCCTCAGGCCCCCAGTGCCTGGCGTTGGGGATCGGCCGCTGGCGTCCTT CGGGGGCGCCTGGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGTAGTCC TCCTCTGCGTAGTAGCACAACCTCGCAGTTGGAACGCGGCGGTGGGCCAT GCCGTTAAACACCCCACTTCTGAAAGTTGACCTCGGATCAGG >R_UP1_3168_P8 36 22 41 51 51 51 51 45 20 26 22 21 27 33 43 41 61 61 61 45 61 61 61 51 57 61 61 61 61 57 45 61 57 61 61 57 49 61 61 61 57 61 61 61 61 61 57 52 61 27 51 57 61 61 55 52 45 61 61 61 61 39 25 61 61 43 33 61 61 61 61 61 61 61 61 61 61 61 61 55 57 61 51 61 61 61 61 61 61 43 41 61 61 61 61 61 61 61 61 61 57 61 61 57 51 61 61 61 61 61 61 55 61 61 61 61 51 61 61 61 61 61 61 61 43 42 61 61 61 45 39 61 61 61 61 61 61 61 47 47 61 52 61 61 51 61 61 61 61 61 61 32 55 61 51 61 61 61 61 61 61 51 42 61 52 61 61 52 61 61 61 61 52 61 61 61 61 52 42 51 51 52 51 47 49 61 61 51 61 61 52 61 61 61 42 61 47 47 51 47 61 55 61 52 51 61 61 61 61 51 61 61 51 52 52 61 52 47 49 61 51 51 61 61 47 31 55 61 51 49 40 61 55 47 61 61 52 41 61 61 52 61 55 52 61 61 61 52 41 61 44 47 52 47 61 49 51 40 51 55 51 61 43 61 40 32 55 51 49 61 52 34 49 51 61 61 47 51 61 47 52 47 61 61 40 51 49 49 49 51 51 52 61 52 38 55 39 61 55 31 61 51 51 46 61 61 45 47 25 52 43 24 25 55 43 27 47 40 55 46 39 51 49 29 49 47 55 51 51 37 51 34 49 55 49 49 52 39 51 46 55 47 40 44 55 47 51 46 51 49 41 51 55 52 47 51 49 43 41 37 30 40 39 52 37 49 39 55 43 51 55 51 32 55 51 49 39 51 44 49 38 44 27 52 30 32 40 44 51 41 43 51 23 39 31 55 49 49 32 23 37 46 41 35 47 40 47 31 32 33 52 41 41 44 35 45 27 40 35 47 34 47 47 31 45 15 24 39 37 36 38 39 20 28 44 21 26 39 40 29 28 24 20 29 47 26 25 27 40 39 26 29 34 35 36 8 24 31 32 47 30 21 10 8 36 36 35 26 47 41 29 34 47 29 35 30 45 29 46 27 19 44 11 16 39 31 27 45 36 40 30 20 31 31 30 45 31 21 32 22 22 22 27 33 24 23 28 27 17 24 29 37 28 29 5 6 20 7 7 14 24 30 29 29 28 28 30 25 7 10 21 29 35 32 14 24 22 22 27 23 29 21 16 27 26 8 22 30 23 29 29 10 16 28 26 29 29 29 23 22 26 26 30 24 17 15 18 18 25 21 20 25 23 40 28 17 18 19 23 28 18 28 17 24 28 22 29 31 30 8 11 26

  38. >R_UP1_3168_P8_Original CAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGG TGAACCAGCGGAGGGATCATTACCGAGTTTACAAACTCCCAAACCCTTTG TGAACCTTACCTATCGTTGCTTCGGCGGGACCGCCCCGACGGCCACCTCG GTGGTCCCGGAACCAGGCGCCCGCCGAAGGCCCCAAACTCTTTGTTTCCT ATGGTTTTCTCCTCTGAGTGGAAAATAAACAAATAAATAAAAACTTTCAA CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAT AAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC ATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCA ACCCTCAGGCCCCCAGTGCCTGGCGTTGGGGATCGGCCGCTGGCGTCCTT CGGGGGCGCCTGGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGTAGTCC TCCTCTGCGTAGTAGCACAACCTCGCAGTTGGAACGCGGCGGTGGGCCAT GCCGTTAAACACCCCACTTCTGAAAGTTGACCTCGGATCAGG >R_UP1_3168_P8_Masked CAAACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGG TGAACCAGCGGAGGGATCATTACCGAGTTTACAAACTCCCAAACCCTTTG TGAACCTTACCTATCGTTGCTTCGGCGGGACCGCCCCGACGGCCACCTCG GTGGTCCCGGAACCAGGCGCCCGCCGAAGGCCCCAAACTCTTTGTTTCCT ATGGTTTTCTCCTCTGAGTGGAAAATAAACAAATAAATAAAAACTTTCAA CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAT AAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC ATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCA ACCCTCAGGCCCCCAGTGCCTGGCGNTGGGGATCGGCCGCTGGCGTCCTT CGGGGNCGCCTGNNCGGCCCCGAAATCTAGNGNNGGTCTCGCTGTAGTCC TCCTCTGCNTAGTANNANNNCCTCGCAGNNGGAANGCGGCGGNGGNCCAT GNNGTTAAACACCCNNNNTCTGAAANNNGANCNCGGATCNNG

  39. Upload your sequences here Upload list of tags as text file here primer = TTTCTT pigtail = TTGGTC

More Related