1 / 33

Genomic Analysis of Marine Viruses

Genomic Analysis of Marine Viruses. Tucson High School Biotechnology Course Spring 2010. What do marine viruses do?. Infect and Kill. What do marine viruses do?. Transfer Genes. +. +. Ex: Photosynthesis genes!!. 10 28 base pairs of DNA per year in world’s oceans.

belden
Download Presentation

Genomic Analysis of Marine Viruses

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genomic Analysisof Marine Viruses Tucson High School Biotechnology Course Spring 2010

  2. What do marine viruses do? Infect and Kill

  3. What do marine viruses do? Transfer Genes + + Ex: Photosynthesis genes!! 1028 base pairs of DNA per year in world’s oceans 10,000,000,000,000,000,000,000,000,000

  4. What do marine viruses do? Alter their hosts + Vibrio cholerae Cholera toxin

  5. What do they infect? What genes do they transfer? How do they alter their host?

  6. We need to use genetics… UNIVERSAL genes Bacteria have 16S gene Eukaryotes have 18S gene NO universal gene for viruses!!

  7. So we use CONCERVED genes

  8. How will WE use genetics? … to find out what type of virus we have. Myovirus Podovirus X X psbA X DNA pol X g23

  9. PCR Forward primer DNA pol Reverse primer standard standard psbA DNA pol g23

  10. How will WE use genetics? … to find out what type of virus we have. Myovirus Podovirus X X psbA X DNA pol X g23

  11. Transmission Electron Microscope e- e- e- Myovirus???

  12. What then? PCR only tells us PRESENCE or ABSENCE DNA Sequencing atatggatcgagcttgac A string of letters… yay. We need BIOINFORMATICS!

  13. Bioinformatics and Genomics Bonnie Hurwitz Graduate student TMPL

  14. What can you do with a sequence? Gene Sequence Align it with gene sequences from other species Create a phylogeny showing how closely related species are to one another

  15. Understand FunctionallyMeaningful Genetic Diversity15 T4-like myoviruses from a diversity of hosts GP2 MIT 9302 MIT 9201 MIT 9312 MIT 9401 AS9601 SB High light Prochlorococcus MIT 9314 MIT 9301 MIT 9215 RS810 MIT 9107 MB11F02 MB11E08 100/100 MED4 MIT 9515 MIT 9211 NATL2A 100/100 Low light Prochlorococcus PAC1 NATL1A SS120 100/98 MIT 9303 MIT 9313 RS8015 WH 8406 100/88 WH 8112 WH 8102 69/-- WH 8103 MB11A04 100/98 MB11E09 97/94 EBAC392 WH 6501 Marine Synechococcus WH 8012 WH 8005 99/64 WH 8002 89/83 WH 8109 WH 8020 100/99 WH 9908 Rocap et al. 2002. AEM WH 8015 70/-- MIT S9220 66/-- WH 8017, WH 8018 59/-- 100/98 RS9705 WH 7803 0.1 substitutions per position 95/93 WH 8101 WH 5701 PCC 6307

  16. What can you do with a lot of sequences?What is a (meta)genome?

  17. community isolate sequencing Genomics Metagenomics

  18. Genome assembly

  19. Genome assembly

  20. …ACGGCTGCGTTACATCGATCAT ACATCGATCATTTACGATACCATTG… genomic DNA Shotgun sequencing (WGS) sheared clone library (insert sizes of 1-2, 3-4, 30-40, 100kb) end sequence clones (f / r) assemble reads by alignment identity

  21. Genome scaffolding H G A B E’ C D F E’’ D contig A G B E F H C break mate pair linkage 4 1 3 7 6 8 5 2 “composite” genome scaffold

  22. Genome annotation is never done …

  23. The first four Prochlorococcus cyanophage genomes • - variations on coliphages (e.g., T4, T7 1 and “lambda” 2) • contain core photosynthesis genes 3,4: • expressed during infection 5,6 • diversity generator for their hosts 4 • comprise ~60% of surface ocean microbial psbA genes 7 • - contain other ‘host’ genes (Auxilliary Metabolic Genes = AMGs8) … phycobilin biosynthesis,P stress, C metabolism, nucleotide metabolism1 P-SSM4 “bacterial” Cyano 11% 15% References: 1 Sullivan et al. 2005. PLoS Biol., 2 Sullivan et al. in prep., 3 Lindell & Sullivan et al. 2004. PNAS, 4 Sullivan & Lindell et al. 2006. PLoS Biol., 5 Lindell et al. 2005. Nature, 6 Lindell et al. 2007. Nature, 7Sharon et al. 2007. ISMEJ , 8Breitbart, Thompson, Suttle & Sullivan. 2007. Oceanography “phage” T4-like 14% Hypothetical 60%

  24. Metagenome assembly

  25. Metagenome assembly

  26. Metagenome assembly

  27. Community complexity Sargasso Sea Soil Acid mine drainage 1 10 100 1000 10000 Species complexity

  28. Community genomics (a.k.a. metagenomics) Environmental Sample Extract DNA Clone High throughput sequence Sheared Size selection Library Type: Shotgun (small-insert) 3kb Fosmid (large-insert) 40 kb BAC (large-insert) BIG STUFF! Assemble reads Call genes Bin fragments

  29. = Environmental Gene Tags What to do with the data?EGTs Predict ORFs (genes) in sequence data Assign a function to ORFs Compare relative abundance across habitats

  30. proteome proteome proteome Metagenomics is but the first level protein transcriptome transcriptome transcriptome RNA genome genome genome DNA viruses bacteria & archaea eukaryotes microbial communities

  31. Summary • The smallest but arguably most important ocean inhabitants are microbes and phages • Using metagenomics to sequence previously undetectable microbes and phages has expanded our knowledge of the oceans’ ecosystems • Looking a genes in genomes can give us an idea of the potential function and role these organisms play in ocean ecology • Looking at gene expression can tell us which genes are playing an active role in the ecosystem and who the major players are

  32. Our goals • Assemble and annotate a phage genome • Next Tuesday and Thursday • Build a gene phylogeny and determine what phage you have based on it’s relationship to other phages • April 6th

  33. higher trophic levels grazers phyto- plankton Dissolved bacteria viral lysis

More Related