pCOLD Vectors and Other Alternative Expression Systems for Structural Genomics

1. pCOLD Vectors and Other AlternativeExpression Systemsfor Structural Genomics

2. Cold- shock adaptation of E. coli < 20 °C 37ºC Optimal GrowthAcclimation Steady Low Temp Growth Stationary Phase Adapted Cells Phase CSPs Growth Curve Non-CSPs CSPs Non-CSPs

3. M13 IG M13 IG pCold II (4.4 kb) cspA 3’UTR cspA 3’UTR pCold I (4.4 kb) multiple cloning site multiple cloning site lacI factor Xa site Amp His6 His6 lacI TEE Amp TEE cspA 5’UTR cspA 5’UTR lac operator lac operator ColE1 ori cspA promoter cspA promoter ColE1 ori M13 IG M13 IG pCold III (4.4 kb) pCold IV (4.4 kb) lacI lacI Amp cspA 3’UTR Amp cspA 3’UTR multiple cloning site multiple cloning site TEE cspA 5’UTR ColE1 ori cspA 5’UTR ColE1 ori lac operator lac operator cspA promoter cspA promoter XbaI XhoI BamHI KpnI HindIII EcoRI SalI PstI NdeI SacI Maps of pCold vectors TEE (translation enhancing element): ATGAATCACAAAGTG (MNHKV) His6: CATCATCATCATCATCAT Factor Xa site: ATCGAAGGTAGG (IEGR) Multiple cloning site: CATATGGAGCTCGGTACCCTCGAGGGATCCGAATTCAAGCTTGTCGACCTGCAGTCTAGA

4. SDS-PAGE of whole cell lysates - E.coli EnvZ ATP-binding domain (EnvZ-B), Xenopus calmodulin (CaM) and E.coli trigger factor expressed using pCold vectors 1 2 1 2 3 4 5 0 12 24 36 48 hr T S EnvZ-B   EnvZ-B 1 2 3 4 5 6 7 EnvZ-B  1 2 1 2 T S T S trigger factor  calmodulin 

5. Expression level and solubility of different proteins - pColdI and pET14 systems E.coli genes Human genes pColdI pColdI pET14 pET14 gene gene expression solubility expression solubility expression solubility expression solubility +++ NS + NS ER6 ++ ++ HR8 +++ +++ + NS +++ + NS ++ ER7 +++ ++ HR31 + NS NS NA ER15 NE NE HR520 NA +++ NS NS ER19 ++ +++ HR521 +++ +++ +++ +++ NA NA ER64 NE NE ++ HR522 NS NA NE ER85 NS + + HR524 NA NS NE NE NA NA NS ER115 ++ ++ ++ HR529 +++ ++ NE NS NS +++ ER130 NS HR535 + ++ +++ +++ NA ER135 HR540 NE NA +++ ++ ++ NE + Drosophila genes C.elegans genes pColdI pET14 pColdI pET14 gene gene expression solubility expression solubility expression solubility expression solubility + ++ FR2 NS ++ ++ NS +++ WR13 +++ NA NE NE NA NA FR4 NE NA NE WR24 + ++ ++ FR5 +++ NS NS +++ WR26 ++ NA NA NE NE FR6 NS NS WR27 +++ +++ NS NS FR14 ++ ++ +++ WR33 +++ +++ +++ FR37 + +++ ++ ++ WR35 NS +++ +++ NS FR48 NA ++ +++ NE WR41 ++ ++ +++ +++ ++ ++ FR59 ++ +++ NS NE WR44 NA + ++ ++ FR70 +++ +++ WR49 NS NS +++ +++ ++ ++ +++ FR78 +++ WR53 +++ +++ +++ +++ In total, 38 genes as shown above were chosen and cloned in pColdI and pET14 vectors, respectively. Samples with better expression level and/or solubility in pET14 were labeled with blue color, and red color for those with better expression and/or solubility in pColdI. NS: not soluble; NE: no expression; NA: not available.

6. [1H-15N]-HSQC spectra of 15N-enriched Xenopus calmodulin produced with pCold vector Purified protein NMR Cell lysate NMR

7. Sequential connectivity map summarizing the results of triple-resonance NMR experiments with calmodulin in whole cell lysates ~ 80% of the peaks are assigned

8. Target Selection, Cloning and Protein Production Identify Target ORF Human, C. elegans, Drosophila, Arabidopsis, yeast and others Validate/ cDNA Clone into Expression Vectors N/C-Terminal His-Tags, pCold, No tag, MBP, SUMO, Pichia, cell-free Insoluble or not expressed Small Scale Expression Soluble Large Scale Fermentation/Protein Purification

9. Multiplex Expression System Classical Restriction Endonuclease/Ligase-dependent cloning E. coli Expression Vectors Eukaryotic Expression systems

10. Expanded multiplex system Attempt to use fusion protein expression systems in place of our standard T7 Multiplex Expression System (Acton et al, submitted) for a set of 50 eukaryotic target proteins 1) Gateway MBP-fusion expression system (Kapust & Waugh 1999) (collaboration with D. Waugh, NCI) 2) SUMO system (Lifesensors, Inc. Malvern, PA) (collaboration with T. Butt, Lifesensors, Inc.)

11. MBP fusion coupled with cleavage by TEV MBP is cleaved from its fusion partner by Tobacco Etch Virus (TEV) Proteinase TEV recognizes the consensus sequence: Glu-X-X-Tyr-X-Gln-Ser (Dougherty et al., 1989) Both in vivo and in vitro cleavage conditions are being investigated (Routzahn & Waugh 2002) Interesting note:Recombinant TEV does not fold properly in vivo and it must be generated as an MBP fusion as well

12. Summary of MBP screening Target pET MBP-fusionin vivo cleavage MBP-fusion uncleaved MBP-fusion in vitro cleavage Target pET MBP-fusionin vivo cleavage MBP-fusion uncleaved MBP-fusion in vitro cleavage WR16 NE NE NE N/A WR2 E/NS NE E/S  low WR18 PE PE  low E/S WR3 E/NS E/S E/S Y WR26 E/NS NE E/S  N/A WR4 E/S E/S E/S Y  WR27 E/NS E/NS E/S  low WR5 NE NE NE N/A WR28 NE NE NE N/A WR6 NE NE E/S Y  WR39 E/S E/S E/S  low WR8 E/S NE E/S Y  WR41 E/S E/S E/S  Y WR9 NE NE NE N/A WR43 E/S E/S E/S  N/A WR10 NE NE E/S  low WR44 NE NE NE N/A WR11 E/S E/S E/S Y  WR49 E/NS E/S E/S  low WR13 E/NS E/NS E/S  N/A WR53 E/S E/S E/S Y  WR14 E/S E/S E/S Y  WR54 E/NS NE NE N/A WR15 NE NE NE N/A Not expressed Expressed/soluble Expressed/insoluble

13. SUMO system 6хHis SUMO Protein of interest SUMP protease (Ulp1) • SUMO is a Ubiquitin-like (UBL) protein • UBLs are small, highly soluble, globular proteins • SUMO has been reported to exhibit chaperone-like activity • Ulp1 is used to cleave the protein target from • the fusion by recognizing the entire SUMO protein • SUMO system utilizes Ni-affinity chromatography • Cleavage must occur in vitro (Figure courtesy of www.lifesensors.com)

14. Summary of SUMO fusion screening Not expressed Expressed/soluble Expressed/insoluble

15. A stable cell-free protein synthesis system prepared from wheat germ Improvement in preparing cell extracts: removing endosperm contaminants, including tritin, thionin, ribonucleases, deoxy ribonucleases, and proteases, by thorough washing and sonication. (Proc. Natl. Acad. Sci. USA 99, 14652-57) CK DHFR Protein synthesis in the dialysis system. (A and B) Coomassie blue-stained SDS polyacrylamide gels showing DHFR synthesis with (A) or without (B) addition of new mRNA. Arrows and asterisks mark DHFR and creatine kinase, respectively. (C) Amounts of DHFR synthesized as determined from densitometric scans of the gels in A (closed circles) and B (open circles). (collaboration with Y. Endo, Ehime University)

16. A cell-free expression vector and its performance GFP mRNA supplement (92 mg in 500 ml reaction each time) (a) Schematic illustration of pEU. (b) SDS/PAGE analysis of GFP produced during 14 days of reaction. mRNA produced by transcription of circular pEU was used for the translation reaction in the dialysis membrane system and was added every 48 h. A 0.1-µl aliquot of the mixture was run on the gel, and protein bands were stained with CBB. The arrow shows GFP; "st" designates an authentic GFP band (0.5 µg).

17. * * * * * * * * * Protein synthesis of human targets by wheat-germ system

18. Summary of screening by cell-free system from wheat germ Not expressed Expressed/soluble Expressed/insoluble

19. Panel of 50 eukaryotic targets in eight expression systems

20. Acknowledgements Guoliang Qing Thomas Acton Tatsuya Sawasaki Li-Chung Ma Rong Xiao Yaeta Endo Ahmad Khorchid Ritu Shastry Kate Drahos G. V. T. Swapna Chi Kent Ho Tauseef R. Butt Tapas K. Mal Natalia Denissova David S. Waugh Masanori Mitta Takayama Bonnie Cooper Bing Xia Kellie Cunningham Sangita Phadtare Liang-yu (Lydia) Shih Haiping Ke Yi-Wen Chiang Gaetano T. Montelione Shin-Geon Choi Mitsuhiko Ikura Masayori Inouye

22. What if…? PCR & cloning of ORFs Construct validation Unexpressed or Insoluble Proteins Small-scale expression & solubility screens

23. Protein Production Pipeline PCR & cloning of ORFs Construct validation Analysis & passing of targets to fermentation Small-scale expression & solubility screens using T7 system Large-scale production & purification of 15N/13C, or selenomethionine-labeled proteins Structure determination by NMR Structure determination by X-ray crystallography