230 likes | 331 Views
Finding relationships and differences by bar-coding jellyfish species. Dr. David Pontin. A beginning. Barcodes. Barcode: A short series of vertical bars representing the digits 0-9, commonly used for product identification.
E N D
Finding relationships and differences by bar-coding jellyfish species Dr. David Pontin
Barcodes • Barcode: A short series of vertical bars representing the digits 0-9, commonly used for product identification. • DNA Barcode: A short length of DNA that is able to differentiate between species. caggggcacgaatcagttaccaaatcctccaattagaactggcattacaaggaaaaagatcataacaaatgcatgagcagttactataacattatagagatgatcatctccaaacatggtaccaggtcctgacaa
Looking for DNA Barcodes • Mitochondrial DNA vs. Nuclear DNA • “fast evolving” tips only of interest • Must work in >90% of examples • 650 bp length of Mitochondrial DNA called cytochrome c oxidase I or COI
DNA Barcoding today • Formally Described Species :72,144 • Total Barcode Records 871,435 • Barcode of life project caggggcacgaatcagttaccaaatcctccaattagaactggcattacaaggaaaaagatcataacaaatgcatgagcagttactataacattatagagatgatcatctccaaacatggtaccaggtcctgacaa
A bit of controversy • What constitutes a species? • Rule of thumb for insects is 2% divergence (13bp) • Cryptic species/species complexes • DNA vs. morphology • COI doesn't work for everything (plants) • Is one gene enough?
Physalia (Siphonophora) Completely pelagic Taxonomically ambiguous Abundant around New Zealand Passive surface dispersal
PhD. goals • Identify the species • Identify important oceanographic variables that influence bluebottle occurrence • Predict bluebottle occurrence
Portuguese Man o War Physalia physalis The Bluebottle Physalia utriculus
Bluebottle locations 54 specimens 13 locations COI and ITS sequenced
Likelihood trees ITS COI Physalia physalis
Hybridisation? • Two explanations for the ones that “jumped ship” • Hybridisation • Ancestral polymorphisum • More likely to be hybridisation • Range overlap • Broad cast spawning • Reported in the Anthozoa
Western Australia 1 • Doesn't fit any clan • If removed, green clan is well supported • What’s going on?
Conflict Tree 2 Tree 1 A A B C 60% 40% B D C D
Achieving goals (or not) • We still don’t know what species of bluebottle occurs in New Zealand • But it is a species complex needing a global review • COI was a good choice but results heighted the need for other markers with “difficult” species
Synergy • Both techniques confirm the existence of two circulatory systems • Molecular data shows what’s there and the models suggest how it got there • Methods allow potential blooming areas to be inferred so that other evidence can be examined in a directed manner • Not possible if methods are considered independently
Wider Picture • How many other jellyfish species could be the same?What does that mean for New Zealand's marine biodiversity? • Population identification has several usages • Pest control: resistance • Population linkages