How can we sequence-specifically target the DNA duplex?

1. Targeting duplex DNA: strategies and applicationsMaxim Frank-Kamenetskiimfk@bu.eduBoston Universityreprints at:http://www.bu.edu/cab

3. How can we sequence-specifically target the DNA duplex?

4. H DNA Triplex   Displaced strand Triplex  Displaced strand  1985

5. base triads Hoogsteen pairing Watson-Crick pairing Hoogsteen pairing Watson-Crick pairing

6. The DNA double helix major groove minor groove

7. Old-fashioned single-molecule experiment JMB 1993 JMB 1993

8. PNA as a tool for targeting duplex DNA

9. PNA PNA – A DNA Mimic with Unique Properties DNA Peptide Nucleic Acidcarries is the same bases as DNA (red), but has a totally different protein-like backbone (blue) Nielsen et al. 1991

10. PNA features  Neutral backbone • Stronger and faster binding to nucleic acids • High sequence-specificity • No nucleic acid  no degradation by nucleases • No peptide  no degradation by protease Strand invasion into duplex DNA

11. PNA/DNA duplexes are more stable than DNA/DNA duplexes

12. FISH of telomeres using PNA Peter Lansdorp (University of British Columbia, Canada)

13. PNA FISH for bacterial detection Staphylococcus aureus (green) AdvanDx Inc. , Woburn, MA

14. PNA openers Triplex Invasion Double Duplex Invasion Homopyrimidine PNA Pseudocomplementary pcPNA any base composition

15. base triads Hoogsteen pairing Watson-Crick pairing Hoogsteen pairing Watson-Crick pairing

16. A pair of pseudocomplementary PNAs (pcPNAs) invade into the DNA double helix in a strictly sequence-specific manner PNAS 2004

17. dsDNA Triplex Invasion Complex “ P-loop “ H2N-Lys-CCTCTCTT Example: linker H-Lys2-JJTJTJTT J C C+ H H H N H H H H C H H R N R N N N N H H H H H H N N+ H O O O H N N N N O R R H H N N N N O O H o o g s t e e n H o o g s t e e n G G H H N N N N N N pairing pairing R R H H W W a a t t s s o o n n - - C C r r i i c c k k pairing pairing Triplex Invasion into Duplex DNA by PNA “Openers” Homopurine site within dsDNA PNA “opener”: Two homopyrimidine PNA oligomers connected by a flexible linker (bis-PNA) + ++ J bases eliminate pH dependence of triplex invasion C*G:C (pH5) J*G:C (pH7)

18. PNA openers = 6-10 5' 3' NH2 COOH 3' 5' PD-loop 3' 5' N=4-10 Targeting duplex DNA through PD-loop • Two PNA openers are able to sequence-specifically hybridize to complementary target sites in duplex DNA • DNA probe can hybridize to the displaced strand forming a stable complex PNAS 1998

19. Capturing duplex DNA using PD-loop Capturing a fragment from the entire yeast genome PD-loop PNAS 1998

20. Applications of PNA openers

21. Hybridization/extension of primer Hybridization/circularization of oligonucleotide Hybridization of DNA or PNA beacon “Artificial primosome” . . . . . . . . . . . . . . . . . . . . . . . . . . . “Earring Probe” . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DNA sequencing, Ligand Mapping F Q Assembly of novel DNA structures, DNA diagnostics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DNA detection PNA openers and some of their applications dsDNA bis-PNA openers homopyrimidine sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Locally open dsDNA

22. Molecularbeacons JACS 2002

23. PNA openers ligand DNA polymerase Nascent DNA strand DNA polymerase pausing due to drug binding to dsDNA JMB 2003

24. Mapping drug’s binding sites on dsDNA via artificial primosome PNA II  PNA I 

25. DNA detectionusing PNA openers

26. PD-loop as a tool for detection of short signature sites

27. New methods of DNA-based detection AEM 2007 BMC 2007

28. E.coli B.subtilis S.mutans Proof-of-principle studies on bacterial cells chosen signature sites: 21-nt-target site in E.coli cold shock protein gene GGAGAGAGACTCAAAAGAAGG 23-nt-target site in B.subtilis the phosphoglycerate dehydrogenase gene GAAAAGAAACCCTTCAGAGGAAG 22-nt-target site in S.mutans the wall-associated protein gene AAAAGAGGTATTTTAAGAGGAA (PNA binding sites are underlined) These sites are unique for each of the bacteria throughout the Bacterial Genomes Database AEM 2007

29. Potential Application:Viral DNA Detection

30. Solid-state nanopore NanoLetters 2010

31. NanoLetters 2010

32. Duplex DNA labeling using nicking enzymes NAR 2008

33. PNA openers Triplex Invasion Double Duplex Invasion Homopyrimidine PNA Pseudocomplementary pcPNA any base composition

34. g-PNA ArtDNA 2010

35. Capturing duplex DNA using PD-loop Capturing a fragment from the entire yeast genome PD-loop PNAS 1998

36. Affinity capture using g-PNA: linear dsDNA ArtDNA 2010

37. Affinity capture using g-PNA: supercoiled DNA (scDNA) ArtDNA 2010

38. Acknowledgements • Boston University • Irina Smolina • Heiko Kuhn • Nancy Miller • Amit Meller and his group • Harvard Medical School • Charles Lee • US Genomics • Katya Protozanova • Gary Jaworski • Rhea Mahabir • Copenhagen University • Peter Nielsen • Carnegie Mellon University • Danith Ly • Funding: • Wallace H. Coulter Foundation. • NIH