1 / 1

5 rrgA-like pilus-associated adhesin C-terminal peptidoglycan-binding motif

sFig. 2. GA-ILR. 13,618. GBS-NM ( vanG -2). 3 parA plasmid partitioning. 1. 2. 6. 7. 8. 9. 10. 4 parB. 5 rrgA-like pilus-associated adhesin C-terminal peptidoglycan-binding motif. C uvrD helicase. B ABC_ATPase Topoisomerase/ primase. A. GA-ILR. 10,585.

briar-maldonado
Download Presentation

5 rrgA-like pilus-associated adhesin C-terminal peptidoglycan-binding motif

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. sFig. 2 GA-ILR 13,618 GBS-NM (vanG-2) 3 parA plasmid partitioning 1 2 6 7 8 9 10 4 parB 5 rrgA-like pilus-associated adhesin C-terminal peptidoglycan-binding motif C uvrD helicase B ABC_ATPase Topoisomerase/ primase A GA-ILR 10,585 R. Intestinalis strain M50/1 1 h 2 3 4 5 6 7 8 9 10 transcriptional represssor, plasmid mobilization 13,666 30,203 GBS-NM (vanG-2) 11 DNA/RNA helicase; methylase 21 VirD4 family conjugation 12 14 15 16 18 19 20 17 relaxase/ plasmid mobilization nuclease domain D DNA-binding transcriptional regulator 13 10,665 26,504 R. intestinalis strain M50/1 11 12 i 13 14 15 16 17 18 19 20 21 30,218 37,305 GBS-NM vanG-2) 25 type IV secretion 24 type IV secretion 27 type IV secretion, RecA-like ATPase 28 peptidoglycan hydrolase 22 23 26 26,519 33,605 * R. intestinalis strain M50/1 22 25 23 24 26 27 28 -35 -10 % sequence identity TTGCTT-N17-TATAAT AAAAAACAGAAACATTTTTTATTTTGAAAG IRR-GA UR S Y W G XY T GBS-NM (vanG-2) >95-100 49,321 42 PemK- like 37 38 39 40 41 43 44 serine recombinase/ integrase 29/30 31 32 33 34 35 36 >90- 95 42,906 37,378 IRR-TTGA <30% R. intestinalis strain M50/1 42,016 * * * 37 j k l m n 39 40’ 41’ 42 43 44 38’ bases 1-27 deleted 33,632

More Related