procaryotes : a single circular chromosome typically 5.10 6 base pairs

1. DNA is organized in chromosomes procaryotes : a single circular chromosome typically 5.106 base pairs eucaryotes : several linear chromosomes typically 3.109 base pairs telomere 5 µm centromere 22 autosomal chromosome pairs Example : human genome + about hundred circular mitochondrial DNA molecules 2 sexual chromosomes

2. Structure and localization of chromosomes • Chromosomes are made of DNA and proteins (chromatin). Histones make DNA more compact and regulate its accessibility (nucleosomes). Transcription factors control gene expression. Replication factors catalyze DNA replication during the S phase of the cell cycle. • Individual chromosomes can be observed during mitosis, one step of cell division (chromatin condensation). Centromeres are contact points between pairs of chromosomes. Telomeres are chromosome ends. • A diploid (haploid) cell possesses 2 (1) set(s) of chromosomes

3. Regulation of DNA accessibility play a crucial role during transcription and replication From ENCODE, an encyclopedy of DNA elements : http://encodeproject.org/ENCODE/

4. 1 ADN  2 ADN • DNA replication is semi-conservative • DNA polymerases • Replication origins • Assembly of the replication fork DNA replication Further readings : http://www.dnaftb.org/dnaftb/ http://www.dnareplication.net/

5. DNA replication is semi-conservative M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958

6. The cell cycle G0 Mitosis In the resting state (G0), cells do not divide Gap 2 Gap 1 DNA Synthesis 6

7. Flow cytometry Fluorescence level Up to 8 fluorophores can be simultaneously analyzed Forward and side scattering is used to analyze cell size and granularity Analysis rate ≈ 10000 cells/sec Several analysis in parallel http://www.abcam.com/

8. The Fluorescence Activated Cell Sorter (FACS)

9. GGATC GGATCCTTAGAACCTTGGCCCGGG CCTAGGAATCTTGGAACCGGGCCC CCTAGGAATCTTGGAACCGGGCCC template DNA synthesis is catalyzed by DNA-dependent DNA polymerases DNA polymerase dATP PPi PPi nucleotides dTTP PPi PPi PPi dCTP PPi primer dGTP 5’ 5’ • DNA polymerization takes place in the 5’ to 3’ direction • DNA polymerase requires a template and a primer dNTP template strand strand to be synthesized 9 Stryer et al. Biochemistry, Freeman Edt

10. DNA replication requires a primase to start • DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 ’ to 3 ’ direction starting at double strand DNA or at a DNA-RNA hybrid • A primase synthesize a RNA primer to initiate replication • DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation dNTP template strand strand to be synthesized

11. Leading and lagging strands Okazaki fragments RNA primase Size of Okasaki fragments : eukaryotes 200 bp 11 Alberts et al. MBOC, Garland Edt

12. On the « leading strand », DNA is continuously synthesized Replication fork primase DNA helicase NTP 3’ 5’ RNA primer DNAPol d DNA helicase dNTP 3’ 5’ 12

13. DNA helicase DNA helicase DNA helicase DNA helicase On the « lagging strand », DNA is synthesized discontinuously Replication fork DNAPol a primase RNA primer NTP 5’ 3’ DNAPol e RNA primer dNTP 5’ 3’ RNAse and DNAPol e RNA primer dNTP 5’ 3’ RNA primer ligase 5’ 3’ 13

14. The core of the eukaryote replication complex DNAPol d DNAPol a primase DNAPol e Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell Linda B. Bloom, University of Florida http://www.med.ufl.edu/IDP/BMB/bmbfacultypages/lindabloom.html • Eukaryote cells possesses several DNA polymerases (> 15) a nucleus 250 kDa DNA primase, lagging strand d nucleus 170 kDa leading strand e nucleus 260 kDa lagging strand,DNA repair 14

15. Main components of the DNA replication complex The catalytic core DNA polymerase a – primase primer RNA synthesis DNA polymerase d, e DNA synthesis, leading+lagging strands Replication protein C* load PCNA on DNA Proliferating cell nuclear antigen (PCNA) sliding clamp ensuring processivity Topoisomerase Adjusts DNA supercoiling Helicase* Unwinds DNA into strands Replication protein A single strand DNA binding protein Flap endonuclease 1 removes RNA 5’-flap Dna2 RNase H1 removes RNA DNA ligase 1 joins Okasaki fragments * uses ATP The replisome Cyclin A, cyclin B1 Cyclin dependent kinase 1, 2 (CDK1, CDK2) + 11 other proteins… Temporal regulation Maga and Hübscher 1996 Biochemistry 35: 5764-5777 Waga and Stillman 1994 Nature 269: 207-212 Frouin et al. 2003 EMBO reports 4: 666-670 Hübscher and Yeon-Soo Seo 2001 Mol. Cells 12: 149-157 15

16. The central role of PCNA • PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp. • PCNA associates with RFC, DNA polymerases d and e, Fen1/Dna2, Lig1 (+ 15 other proteins !) • PCNA is also involved in DNA repair mechanisms At 3’ OH end : RFC displaces Pol-a and loads PCNA + Pold/e At the flap structure : RFA dissociates Pole from PCNA PCNA recruits Fen1/Dna2 which cleaves the flap structure PCNA recruits Lig1 that joins the DNA fragments PDB 1AXC Maga and Hübscher 2003 Journal of Cell Science 116: 3051-3060 16

17. Replication is coordinated at replication factories • Visualization of DNA replication in living cells using GFP-PCNA • FRAP experiments shows that PCNA is stably associated to replication factories GFP PCNA 17 Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59

18. Replication is coordinated at replication factories • Visualization of DNA replication in living cells using GFP-PCNA • FRAP experiments shows that PCNA is stably associated to replication factories 18 Essert et al. 2005 Mol. Cell Biol. 25 : 9350-59

19. ORC : origin replication complex MCM : minichromosome maintenance complex Replisome Replication starts at replication origins 1. Activation 2. Extension 3. Termination • There are about 100-1000 replication origins per chromosome • Replication origins are recognized by specific protein complexes : ORC ‘origin recognition complex) and MCM (minichromosome maintenance complex) • Replication speed : 10-50 bp/s • The onset of DNA replication is triggered by « cell division cycle dependant kinases » (CDK) 19

20. ADN1 + ADN2  ADN3 + ADN4 • Mécanisme moléculaire de la recombinaison homologue • La recombinaison de sites spécifiques • La conjugaison, mécanisme de la parasexualité bactérienne • La recombinaison VDJ, un des éléments de la diversité des anticorps et des TCR • Le crossing-over durant la méiose accroît la diversité génomique de la population • Les transposons et les virus, séquences d’ADN mobiles Les recombinaisons: modifications aléatoires et programmées du génome

21. The mechanism of homologuous recombination homology Holliday junction cleavage exchange cleavage ligation ligation displacement

22. RecA proteins catalyze the exchange of DNA strands ... Structure of a RecA polymer ATP hydrolysis ATP binding site

23. … in the 5’ to 3’ direction without RecA with RecA … dans un seul sens Driving force : ATP hydrolysis

24. Recombination events in cells Example Cells Effect Effector proteins Crossing-over Meiotic cells genome RecA-D like ( germinal cells) rearrangements proteins Virus integration Host cell genome dormancy Integrase lytic/lysogenic Integration Host phases Factor Conjugation Bacteria gene exchange Integrase VDJ recombination lymphocytes antibody and Rag1-2 TCR diversity Transposons all cells genome Transposases rearrangements

25. Example 1 : site-specific recombination of a virus The two states of the bacteriophage l Reversible recombination DNA of the bacterio phage l attP DNA of E. coli attB ExcisionaseIntegrase Integration Host Factor Integrase Integration Host Factor Recombinant DNA

26. Integrase mechanism phage l DNA attP E. Coli DNA attB recombinant DNA pairing, double cleavage, double exchange, ligation

27. phage DNA attB attP bacterial DNA Conformation 1 : phage and bacterial DNA separated Conformation 2 : phage and bacterial DNA fused

28. integration Phage integration in bacterial genome excision Biswas et al. (2005) A structural basis for allosteric control of DNA recombination by λ integrase Nature 435 : 1059-1066

29. The F-factor allows gene exchange between bacteria Conjugation Reversible recombination factor F « female » chromosome integration DNA Hfr chromosome excision « male » plasmide F ’ episome F • F’ plasmids often carry virulence factors

30. blasticidineR gène cible Recombinaison (double crossing-over) blasticidineR WT Dphg1a Dphg1b Dphg1a/b PHG1A ampicillineR Anti-PHG1A PHG1B Anti-PHG1B Benzhegal et al. 2002 Applications de la recombinaison : invalidation de gène par insertion

31. Applications of recombination : the Cre-Lox system Cre recombinase : a P1 phage enzyme that catalyzes recombination between two LoxP sequences : LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT Example : RIP-CreER transgenic mice have a tamoxifen inducible Cre-mediated recombination system driven by the rat insulin 2, Ins2, promoter. The transgene insert contains a fusion product involving Cre recombinase and a mutant form of the mouse estrogen receptor ligand binding domain. The mutant mouse estrogen receptor does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the Cre/Esr1 protein can only gain access to the nuclear compartment after exposure to tamoxifen. When crossed with a strain containing a loxP site flanked sequence of interest, the offspring are useful for generating tamoxifen-induced, Cre-mediated targeted deletions. Tamoxifen administration induces Cre recombination in islet cells of the pancreas. About 100 loxP-flanked genes bearing strains are available at Jackson

32. Example 2 : genetic rearrangements in B lymphocytes Light chain k of antibodies recombination splicing RAG : recombination activating genes RSS : recombination signal sequences

33. Transposons are mobile DNA sequences in genomes transposase transcription traduction excision insertion example : Tn5 transposon and transposase

34. Viruses and transposons Transposons Viruses • no specific insertion sites • frequency of mobility: 10-6 per generation • Abundance variable in genomes (10% in drosophila, 40% in men) • coat proteins • use receptors to enter the cells type I transposons (retrotransposons) RNA viruses type II transposons DNA viruses

35. Fast and slow viruses • Fast viruses • Slow viruses

36. The presence of transposons allows gene duplication, inversion or excision by homologous recombination DELETION INVERSION DUPLICATION

37. Mitosis, meiosis and fecundation example of a diploid organism with 2 pairs of homologous chromosomes diploid gametes diploid 2 haploids 2 diploids diploid 4 haploids MITOSIS FECUNDATION MEIOSIS

38. Mitotic spindle separation of sister chromatides DNA replication decondensation of chromosomes Chromosome condensation centromeres separation of daughter cells (cytokinesis) Sister chromatides Mitosis : 1 diploid -> 2 diploids

39. DNA replication Chromosome condensation centromere Sister chromatids Meiosis : 1 diploid -> 4 haploids synaptolemalcomplex Pairing of homologous chromosomes 1st mitosis separation of homologous chromosomes 2nd mitosis gametes

40. simple chromosome paternel chromosome maternel • séquences homologues • fréquence : 1/107 paires de bases double Transmission non-mendélienne « Crossing over » Transmission de l ’ADN mitochondial • transmission presque exclusivement par la mère Epigénétique • Certains gènes sont inactivés par méthylation, l ’état de méthylation peut être transmis aux cellules filles • Exemple : inactivation d ’un des chromosomes X chez les femmes

41. réplication de l ’ADN condensation des chromosomes centromère chromatides sœurs Recombinaison durant la méiose Complexe synaptolemal appariement des chromatides homologues et crossing-over 1ière mitose ségrégation des chromosomes homologues 2ième mitose gamètes

42. L’ADN simple brin est généré par l ’action d ’une hélicase et d’une endonuclease du complexe RecBCD • Chez E. coli, la recombinaison homologue a lieu à des sites spécifiques appelés « chi site » dont la séquence est GCTGGTGG, situés environ toutes les 4000 paires de base • Chez E. coli, la recombinaison est catalysée par l ’action de quatres protéines RecA, RecB, RecC et RecD

43. DNA repair • Molecular origin of DNA mutations • General repair mechanisms • The p53 protein controls DNA damage at a specific checkpoint of the eukaryote cell cycle

44. Sources of DNA damage Replication errors: DNA polymerase frequency 1/107 Molecular damages to DNA: Origin DNA damage number/cell.day Possible repair Exogenous sun (1h/day) T-T dimers 6-8.104 Y chemical adducts 102-105N (base modification) radioactivity single strand breaks 2-4.104 Y (natural double strand breaks ? ± background) Endogenous temperature single strand breaks 2-4.104 Y free radicals adducts/breaks 104 Y metabolites adducts 102 Y viruses genome integration ? N transposons ? ?

45. DNA repair mechanisms Damage type Repair • Recognition T-T dimers Adducts Single strand breaks Double strand breaks • Restriction • Excision • Synthesis • Ligation • Excision • or direct ligation • Recombination • Ligation

46. The COMET assay to measure DNA damages also called single cell gel electrophoresis (SCGE)

47. Ames test (Salmonella-his reversion-test ) for mutagenicity This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony. The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations. The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes. Brian Krug: Ames Test: Chemicals to Cancer chemical to be tested Inhibition zone growth ring Strain # S. typhimurium Type of Mutation Detected Strain Name 1 TA98 detect frame-shift mutations 2 TA100 detect base pair substitutions 3 TA102 detect excision repair 4 TA104 detect base-pair substitutions 5 TA1534 detect frame-shift mutation 6 TA1530 detect base pair substitutions

48. Exemple of repair : thymine dimers (induced by UV light) Tymine dimer repair enzyme : specific DNA endonuclease

49. translocation to the nucleus aromatic molecule (L) Aryl hydrocarbon Receptor AhR AhR-L AhR-L AhRE AhRE induction of specific mRNA (AhRE) P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1 Phase II enzymes : GST, UGT (detoxification mechanism) Growth Differentiation Metabolism (toxicity) CYP1A1, CYP1A2 epoxide hydrolase the diol epoxide covalently binds to DNA (adduct) Increased DNA mutations & cancer benzo[a]pyrene-7,8-dihydrodiol -9,10-epoxide Metabolism et carcinogenicity of Benzo[a]Pyrene Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 °C. benzo[a]pyrene (BP)

50. Shimizu et al. (2000) PNAS 97 : 779-782 Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor Individual susceptibility to xenobiotics. Exemple of CYP genes Dossier INSERM Dioxines dans l’environnement. Quels risques pour la santé? http://ist.inserm.fr/basisrapports/rapport.html