Monitoring aquatic amphibian and reptile populations using environmental DNA

1. Monitoring aquatic amphibian and reptile populations using environmental DNA Katherine M. Strickler, Caren S. Goldberg, and Alexander K. Fremier

2. Outline • What is eDNA? • When do we use it? • How do we collect and detect eDNA? • DoD projects: methods and preliminary results • Conclusions • Protocols

3. What is eDNA?

4. DNA in the aquatic environment UV endonucleases/ exonucleases DNA of ~100 bp can persist 2 – 3 weeks (Dejean et al. 2011)

5. eDNA original papers

6. Bullfrog detection (Dejean et al. 2012) Field surveys eDNA surveys 7 ponds 14% 38 ponds 77%

7. Bullfrog detection (Dejean et al. 2012) Field surveys eDNA surveys 7 ponds 14% 38 ponds 77%

8. eDNA research

9. eDNA research • Marine fish (Thomsen et al. 2012) • Marine mammals (Foote et al. 2012) • New Zealand mudsnails (Goldberg et al. 2013) • Hellbenders (Olson et al. 2012, Spear et al. submitted) • Burmese python (Piaggio et al. 2013) • Brook trout, bull trout (Wilcox et al. 2013 , this study) • Chinook salmon (Laramie 2013, this study) • Bd (Schmidt et al. 2013 , this study) • Ranavirus (this study)

10. Advantages of eDNA • Non-destructive • Highly sensitive – higher detection probabilities • Multi-species detections (including pathogens) • Reduced need for taxon-specific field training • Reduced permitting requirements

11. When do we use eDNA? • Under what circumstances is eDNA sampling more efficient than standard field surveys? • Likely will differ by species and system

12. When do we use eDNA? • Under what circumstances is eDNA sampling more efficient than standard field surveys? Field sampling more cost-effective eDNA sampling more cost effective Detection eDNA sampling High density populations Low density populations Effort

13. How do we collect eDNA?

14. Water sampling

15. How do we detect eDNA? • DNA extraction (DNeasy/Qiashredder) • Quantitative PCR (qPCR)

16. eDNA projects - DoD Fort Huachuca (AZ) • Arizona treefrog • Northern Mexican gartersnake • Chiricahua leopard frog • Sonora tiger salamander • American bullfrog • Ranavirus • Bd

17. eDNA projects - DoD Eglin Air Force Base (FL) • Reticulated flatwoods salamander • Ornate chorus frog Yakima Training Center (WA) • Bull trout, brook trout • Spring and fall Chinook salmon

18. Developing species-specific guidance • Collect 4 replicate water filter samples in coordination with field surveys • Compare detection probabilities of eDNA vs. field surveys

19. Developing species-specific guidance • Collect environmental covariates • UV exposure • Conductivity • Water temperature • pH • Area • Volume • Use occupancy modeling to determine effects of covariates on detection probabilities

20. Developing species-specific guidance

21. Arizona treefrog detection (1.0) • 15 sites sampled • Detected at 4 sites • 1.0 detection probability

22. Chiricahua leopard frog detection (0.65) • 20 sites sampled • 1 site detected by field crews missed by eDNA • 2 sites detected by eDNA missed by field crews

23. Chiricahua leopard frog detection probability

24. Chiricahua leopard frog detection probability Take samples at 2 locations Take samples at 3 locations

25. American bullfrog detection (0.72) • 50 sites sampled • 1 site detected by field crews missed by eDNA • 4 sites detected by eDNA missed by field crews

26. American bullfrog detection probability

27. American bullfrog detection probability 2 samples 3 samples 4 samples 5 samples

28. Sonora tiger salamander detection (0.73) • 23 sites sampled • 3 sites detected by field crews missed by eDNA • 1 site detected by eDNA missed by field crews

29. Sonora tiger salamander detection probability

30. Sonora tiger salamander detection probability

31. Conclusions • eDNA detection varies by species • Sampling protocols need to maximize detection • Season for sampling • Number of replicates • Spatial distribution of replicates • Volume sampled • Preservation method • Extraction method • Analysis method • Pilot study is critical • eDNA sampling can complement field surveys

32. Protocols • Field protocol • Lab protocols • Guidelines for eDNA sampling programs

33. Field protocol • Materials • Sample collection • Filtration • Contamination prevention

34. Lab protocol Guidelines for selecting a laboratory to process eDNA samples • Facilities (clean room) • Techniques (qPCR or next-gen sequencing) • Standard practices • Positive and negative controls

35. Preliminary guidelines Generalized guidelines for designing eDNA sampling programs • Determine the most appropriate season to conduct eDNA surveys • Consider spatial sampling design • Consider filter type • Consider preservation method • Conduct a pilot study • Consider how eDNA sampling can complement existing field methods

36. Thank you

37. Backup Slides

38. DNA barcoding • All individuals within a species share particular sequences Thamnophis eques (mtDNA): …gaaaggccctaacctggtaggaccaata… Thamnophis cyrtopsis (mtDNA): …gaaaggcccCaacctAgtaggaccaata… Wood et al. 2011 www.barcodeoflife.org

39. Quantitative PCR (qPCR) Blue – long-toed salamander test Green – positive control More DNA Less DNA

40. qPCR negative – Idaho giant salamander Blue – long-toed salamander test Green – positive control

41. qPCR multiplex Red – Arizona treefrog Blue – Bd Green – positive control

42. eDNA qPCR Quantification as well as presence/absence Pilliod et al. 2013

43. eDNA assay process Identify target species set Collect DNA sequence data Create and verify qPCR test Collect replicate water samples from DoD sites eDNA test development: eDNA test application: Analyze detection data Run qPCR test

44. Detection probabilities

45. Northern Mexican gartersnake (0.17)

46. eDNA FAQs Can we use eDNA for Species X? Can we use eDNA to estimate abundance/density? What are the chances of a false positive? How much does it cost? How far downstream can eDNA be detected in streams?