Synthetic auxotrophs for containment Online training modules and certification

1. Assessing and mitigating biosafety risks in synthetic biology J. Christopher Anderson UC Berkeley Bioengineering SynBERC • Synthetic auxotrophs for containment • Online training modules and certification • Formal framework for assessing risk

2. Synthetic auxotrophy for the containment of engineered microbes

3. Requirements of biosafety strain • Disenable the transfer of DNAs to and from the organism • rE. coli (codon swapping)? • Restrict the growth of the organism to the application environment • dapD mutants? • Unnatural amino acid dependence? • Self-destruct devices? • Synthetic auxotrophes?

4. Additional requirements • Modifications cannot be escaped by complementation • Modifications cannot revert through natural mutation mechanisms • Sufficiently inexpensive to allow use in a large bioreactor for production of commodity chemicals • No adverse impact on the stability, metabolic load, growth rate, or gene expression of the organism • Be extensible to industrially-relevant organisms

5. Synthetic Auxotrophs

6. ToxR One-Hybrid System

7. Training modules for assessing biosafety risks

8. Biological Use Authorization

9. Biological Use Authorization “Section VI - Scope of Work Narrative: Describe in lay terms the goal/purpose of experiments, methods and equipment used in the experimental procedures. Include safety/containment procedures, as well as decontamination and disinfection processes applied during the conduct of research. In particular, two areas must be addressed- indicate if you will be autoclaving your agent/recombinant DNA waste and describe your spill clean-up procedures. Narrative must address the potential sources of risk to personnel (e.g., aerosol generation) and/or the environment (e.g. pollen or interbreeding with wild species) and how these risks will be managed. Indicate if over 10 liters of culture shall be generated or if agents shall be concentrated. Explain any boxes checked in Section V. Limit the narrative to one page (page 4 of the BUA Form).” Are there any risks associated with dual use? How do you assess these risks?

10. Assessment of Risk • Factors considered in determining the level of containment include the following information regarding the agent itself: • Virulence/pathogenicity/infectious dose • Environmental stability • Route of spread, communicability • Quantity/concentration/volume used • Vaccine/Treatment availability • Allergenicity • Potential for nefarious dual use

11. Training Module for Biosafety

12. Training Module for Biosafety • Does your system include any components from a risk group 2(+) organism? • Are any of those components known virulence factors? • Does your system contain any components associated with select agents? • Would you expect your agent to cause risk to human, animal, or plant health? • Would you expect your organism to persist in the environment?

13. Formal assessment of biosafety risks

14. Why formalize? • Software-derived inference mitigates the risk of lazy or incomplete subjective assessments • When systems become more complex, it will be harder to assess risk subjectively • If you can teach a computer to do things automatically and reach the correct answer for all cases, then you have found a complete formal theory • Analyzing what things do is often easier when you approach it from the perspective of a formalism • In the context of risk, it provides a concrete justification for the assessment and a common vocabulary for discourse

15. First Attempt Ben Bubenheim • What is the highest risk group of any specific component of the system? (all features and the chassis) • Conventional wisdom is to start with the highest risk group and work downward • Presence of select agent is usually deterministic

16. Payload Delivery Device Jin Huh Source organism risk group: 1 2 1 1 1 1 1 1 2 2 1 1 1 1 1

17. Assessing Risk of Devices: The payload delivery device tnp gfp tn tn Payload Delivery Device Peuk Peuk Source organism risk group: 1 1 1 1 1 1 1 1

18. Elements of risk • The chassis itself can be dangerous • Any individual component could be dangerous by virtue of its molecular function; the context of a dangerous component is irrelevant • A device could be more dangerous then the sum of its components, independent of the chassis • In the context of certain chassis, a particular device could become dangerous i.e. Shigella flexneri strain 2457T i.e. ricin orf and all its encodings i.e. maitotoxin biosynthetic pathway i.e. ToxR in Vibrio cholerae

19. Elements of risk • You must include natural mechanisms of evolution in the assessment of risk for a given Strain (chassis + sequence modifications) • You must include any potential risks of dual use of the component Features or compositions thereof enabled by the availability of the DNAs introduced • …so, ultimately, need a framework that describes risks based on compositions of “Features” (= Devices) provided a specific “Strain” Therefore, cis relationships are irrelevant Therefore, only essential components should be part of the description of the dangerous composition What exactly is a “Device”?

20. Act Basics Saurabh Srivastava, Jonathan Kotker, Ras Bodik, Sanjeet Seshia EECS, UCB It’s (super) Family Ptet_R0040 A Feature tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac

21. Act Basics It’s (super) Family Ptet_R0040 A Feature tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac s70 and transcription TetR

22. Act Basics: an autorepression device LacI Cro lacI P_tac cro P_RM TetR tetR Ptet_R0040

23. Act Basics: an autorepression device trans cis X x Px

24. So what is a device? “A graph wherein the nodes are families and the edges are cis or trans relationships between the families” • Devices can exist at multiple levels of abstraction based on how specific a family is chosen for each node • Particular parts instantiate a device if features belong to the device’s families and their inferred cis and trans relationships are a subgraph of the device

25. What does Act give you? • Provided a Strain composition, it enables inference of the devices that resulted from your modifications • It can describe abstractions of the device that address substitutions of features, point mutants, etc. • Provided a list of “devices of interest” it can tell you whether a strain contains any of those devices What’s missing? • The mapping of dangerous cellular function to devices • Enumeration and classification of expected dangerous cellular functions

26. Some dangerous things… • A yeast cell expressing the active form of prion • A lab strain of E. coli with various modifications throughout its genome to enable oral to intestine colonization that constitutively expresses ricin • A probiotic strain of E. coli that has been transformed with a morphine biosynthetic device. • An engineered Salmonella strain with a cell-surface displayed peanut eptitope